Rorug03G0265500

Protein phosphatase 2C 57-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
25893214 .. 25893414
201 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0265500.1

Sequence Viewer

Length: 201 bp
ATGGCGTCACCCACTCCCGGAATCCTCCTCCGGCTCCTCCAGTCCATGAACTCCGCCACCAAAGTCACCGGCGACCATCGCTCTGCCCTGCTCCAAGTCATCGGCATAGTCCCCGCCCTGCTCCGACGACCTCTGGCCCAACCAAGGCTTCTACGTCCAGCTCTCCTACTCCCTCAACTCCACCTACGTCGCCCTCTCTGA

Protein Analysis

66

Amino Acids

7.26

Weight (kDa)

12.0

Isoelectric Point (pI)

89.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF936 PF06075 5 - 40 8.7e-13 Plant protein of unknown function (DUF936)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 54, 114
AcyI GRCGYC 1 cut(s) 5
AfiI CCNNNNNNNGG 2 cut(s) 17, 144
AjuI GAANNNNNNNTTGG 2 cut(s) 132, 164
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
AoxI GGCC 1 cut(s) 135
AspS9I GGNCC 1 cut(s) 136
AsuC2I CCSGG 1 cut(s) 18
AsuHPI GGTGA 1 cut(s) 58
BccI CCATC 1 cut(s) 84
BcnI CCSGG 1 cut(s) 18
Bme1390I CCNGG 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 18
BpmI CTGGAG 1 cut(s) 23
BpuMI CCSGG 1 cut(s) 18
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 143
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 144
Bse118I RCCGGY 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 40
BseDI CCNNGG 1 cut(s) 143
BseLI CCNNNNNNNGG 2 cut(s) 17, 144
BseNI ACTGG 1 cut(s) 40
BseRI GAGGAG 2 cut(s) 17, 26
BshFI GGCC 1 cut(s) 137
BsiSI CCGG 3 cut(s) 18, 31, 69
BslFI GGGAC 1 cut(s) 95
BslI CCNNNNNNNGG 2 cut(s) 17, 144
BsmFI GGGAC 1 cut(s) 95
BsnI GGCC 1 cut(s) 137
BspACI CCGC 2 cut(s) 54, 114
BspANI GGCC 1 cut(s) 137
BspLI GGNNCC 1 cut(s) 35
BsrFI RCCGGY 1 cut(s) 68
BsrI ACTGG 1 cut(s) 40
BssAI RCCGGY 1 cut(s) 68
BssECI CCNNGG 1 cut(s) 143
BssNI GRCGYC 1 cut(s) 5
BssT1I CCWWGG 1 cut(s) 143
BstACI GRCGYC 1 cut(s) 5
BstMWI GCNNNNNNNGC 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 16
BsuRI GGCC 1 cut(s) 137
BtgZI GCGATG 1 cut(s) 62
Cfr10I RCCGGY 1 cut(s) 68
Cfr13I GGNCC 1 cut(s) 136
CviAII CATG 1 cut(s) 46
CviJI RGCY 4 cut(s) 34, 137, 148, 161
CviKI_1 RGCY 4 cut(s) 34, 137, 148, 161
EciI GGCGGA 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 143
EcoT14I CCWWGG 1 cut(s) 143
ErhI CCWWGG 1 cut(s) 143
FaeI CATG 1 cut(s) 49
FaiI YATR 2 cut(s) 47, 107
FaqI GGGAC 1 cut(s) 95
FatI CATG 1 cut(s) 45
FauI CCCGC 1 cut(s) 121
GsuI CTGGAG 1 cut(s) 23
HaeIII GGCC 1 cut(s) 137
HapII CCGG 3 cut(s) 18, 31, 69
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 1 cut(s) 49
HinfI GANTC 1 cut(s) 21
HpaII CCGG 3 cut(s) 18, 31, 69
HphI GGTGA 1 cut(s) 58
Hpy188I TCNGA 2 cut(s) 125, 200
Hpy99I CGWCG 2 cut(s) 129, 192
HpyCH4IV ACGT 2 cut(s) 154, 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 78
HpySE526I ACGT 2 cut(s) 154, 187
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 1 cut(s) 49
LmnI GCTCC 3 cut(s) 39, 96, 126
LpnPI CCDG 8 cut(s) 31, 44, 53, 82, 101, 119, 131, 171
MaeII ACGT 2 cut(s) 154, 187
MaeIII GTNAC 2 cut(s) 6, 64
MmeI TCCRAC 1 cut(s) 148
MnlI CCTC 5 cut(s) 35, 38, 47, 141, 183
MspI CCGG 3 cut(s) 18, 31, 69
MspR9I CCNGG 1 cut(s) 18
MwoI GCNNNNNNNGC 1 cut(s) 78
NciI CCSGG 1 cut(s) 18
NlaIII CATG 1 cut(s) 49
NlaIV GGNNCC 1 cut(s) 35
NmuCI GTSAC 2 cut(s) 6, 64
PfeI GAWTC 1 cut(s) 21
PfoI TCCNGGA 1 cut(s) 16
PspN4I GGNNCC 1 cut(s) 35
PspPI GGNCC 1 cut(s) 136
Sau96I GGNCC 1 cut(s) 136
ScrFI CCNGG 1 cut(s) 18
SetI ASST 5 cut(s) 133, 157, 163, 186, 190
SgrAI CRCCGGYG 1 cut(s) 68
SsiI CCGC 2 cut(s) 54, 114
StyD4I CCNGG 1 cut(s) 16
StyI CCWWGG 1 cut(s) 143
TaiI ACGT 2 cut(s) 157, 190
TfiI GAWTC 1 cut(s) 21
TseFI GTSAC 2 cut(s) 6, 64
Tsp45I GTSAC 2 cut(s) 6, 64
TspDTI ATGAA 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.