Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002095.1

Orthogroup ID

OG0002353

Physical Location & Seq

Genomic Coordinates Forward (+)

27355 .. 28143

Gene Structure 789 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002095.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 789 bp

ctggtggagattccgaccggagatcgaacttggaatccccttgttgctcgtcaggcatcatctcgtataaggtcttgtataagatcatcacctaactcttcttcgtttgatacggcggcgtcggagttcgagttctcagctcgattcgggtcgaatggatctactgctacctggccgatgagcttggcagatgagctattcttgaatggaaagattcggcccatgaagctctccacccacctggaaaagccccaggcgccgttgcaagctgtcaatgaggaagatggagatgatctattcgagttcgggctgctgagaggcagagatctgaggatgagggacaactctttgtggcggagaacgagatccatgtctccgatgagaaacatgccctttggtaataatgactgttgctttgcgaaagatctgaaggagggtgatttagggaaaaagaagaagaaactggagaatggtgaggaggaggaggaggaagaagaagttgggagcttggagactactccttcggtttcagcttcgtcttcaagatcatcctcagctagaagaaactcgaaaagatgggtctttctgaaagattttctccacaagagtaaaactgaagggaggagtactaataacaaattctgggccacaatctcattcttgagtagtggtaaggagaagaaaatagaggtaagtgttgggggagaaaataggcagaaaattggctcgtccgagacaatttgcaaactacactcatacaacagatatcactattctgttgtacaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1645

Protein Analysis

262

Amino Acids

29.61

Weight (kDa)

9.13

Isoelectric Point (pI)

61.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002353)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G62630
fragaria_vesca	FvH4_6g07220 FvH4_6g07220 FvH4_6g07220
malus_domestica	MD04G1195400.v1.1 MD12G1207500.v1.1
prunus_persica	Prupe.6G315100_v2.0.a1
pyrus_communis	pycom04g17260 pycom12g19510 pycom15g32780
rosa_chinensis	RchiOBHm_Chr1g0333511 RchiOBHm_Chr1g0352421 RchiOBHm_Chr2g0129671 RchiOBHm_Chr3g0456851 RchiOBHm_Chr5g0038721 RchiOBHm_Chr6g0249361
rosa_laevigata	RLG00000023272 RLG00000025274
rosa_multiflora	Rmu_co8019462.1_g000001 Rmu_sc0000133.1_g000019 Rmu_sc0000741.1_g000014 Rmu_sc0001016.1_g000061 Rmu_sc0001890.1_g000010 Rmu_sc0002095.1_g000008 Rmu_sc0002955.1_g000021 Rmu_sc0005500.1_g000015 Rmu_sc0010617.1_g000006 Rmu_sc0020548.1_g000004 Rmu_sc0020548.1_g000005 Rmu_sc0033338.1_g000001
rosa_roxburghii	Rroxscaffold_3G00223580 Rroxscaffold_6G00422440
rosa_rugosa	Rorug03G0016400
rosa_samantha	Rh1AG132800 Rh1AG157400 Rh1CG147200 Rh3AG076700 Rh3BG078500 Rh3CG078300 Rh3DG080300 Rh4DG243900
rosa_wichuraiana	Rw3G006580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	256
AciI	CCGC	2 cut(s)	116, 355
AclWI	GGATC	2 cut(s)	166, 360
AcoI	YGGCCR	1 cut(s)	173
AcsI	RAATTY	1 cut(s)	638
AcuI	CTGAAG	2 cut(s)	449, 636
AcyI	GRCGYC	2 cut(s)	119, 257
AfaI	GTAC	2 cut(s)	628, 783
AgsI	TTSAA	2 cut(s)	205, 543
AjnI	CCWGG	3 cut(s)	170, 240, 252
AjuI	GAANNNNNNNTTGG	2 cut(s)	483, 515
AloI	GAACNNNNNNTCC	4 cut(s)	19, 51, 116, 148
AluBI	AGCT	8 cut(s)	140, 183, 196, 229, 269, 507, 533, 557
AluI	AGCT	8 cut(s)	140, 183, 196, 229, 269, 507, 533, 557
Alw26I	GTCTC	3 cut(s)	378, 506, 728
AlwI	GGATC	2 cut(s)	166, 360
AoxI	GGCC	3 cut(s)	173, 218, 645
ApeKI	GCWGC	1 cut(s)	310
ApoI	RAATTY	1 cut(s)	638
ArsI	GACNNNNNNTTYG	4 cut(s)	398, 430, 505, 537
AspLEI	GCGC	1 cut(s)	259
AspS9I	GGNCC	2 cut(s)	219, 645
AsuHPI	GGTGA	3 cut(s)	81, 449, 485
BanI	GGYRCC	1 cut(s)	256
BbsI	GAAGAC	1 cut(s)	531
BbvCI	CCTCAGC	1 cut(s)	553
BbvI	GCAGC	1 cut(s)	297
BccI	CCATC	2 cut(s)	278, 570
BceAI	ACGGC	2 cut(s)	129, 244
BciT130I	CCWGG	3 cut(s)	172, 242, 254
BcoDI	GTCTC	3 cut(s)	378, 506, 728
BfaI	CTAG	1 cut(s)	558
BfoI	RGCGCY	1 cut(s)	260
BglII	AGATCT	2 cut(s)	325, 424
BisI	GCNGC	2 cut(s)	117, 311
BlsI	GCNGC	2 cut(s)	118, 312
BmcAI	AGTACT	1 cut(s)	628
Bme1390I	CCNGG	3 cut(s)	172, 242, 254
BmgT120I	GGNCC	2 cut(s)	219, 645
BmiI	GGNNCC	1 cut(s)	258
BmrFI	CCNGG	3 cut(s)	172, 242, 254
BmsI	GCATC	1 cut(s)	65
BpiI	GAAGAC	1 cut(s)	531
BpmI	CTGGAG	1 cut(s)	485
Bpu10I	CCTNAGC	1 cut(s)	553
BpuEI	CTTGAG	1 cut(s)	682
BsaHI	GRCGYC	2 cut(s)	119, 257
BsaJI	CCNNGG	1 cut(s)	252
BsaWI	WCCGGW	1 cut(s)	17
BsaXI	ACNNNNNCTCC	2 cut(s)	116, 146
Bse1I	ACTGG	1 cut(s)	468
BseBI	CCWGG	3 cut(s)	172, 242, 254
BseDI	CCNNGG	1 cut(s)	252
BseGI	GGATG	2 cut(s)	339, 548
BseMII	CTCAG	4 cut(s)	150, 305, 320, 567
BseNI	ACTGG	1 cut(s)	468
BseRI	GAGGAG	5 cut(s)	491, 494, 497, 500, 637
BseXI	GCAGC	1 cut(s)	297
Bsh1285I	CGRYCG	1 cut(s)	18
BshFI	GGCC	3 cut(s)	175, 220, 647
BshNI	GGYRCC	1 cut(s)	256
BsiEI	CGRYCG	1 cut(s)	18
BsiSI	CCGG	1 cut(s)	18
BslFI	GGGAC	1 cut(s)	353
BsmAI	GTCTC	3 cut(s)	378, 506, 728
BsmFI	GGGAC	1 cut(s)	353
BsnI	GGCC	3 cut(s)	175, 220, 647
Bsp1407I	TGTACA	1 cut(s)	781
Bsp143I	GATC	8 cut(s)	22, 83, 158, 292, 325, 365, 424, 545
BspACI	CCGC	2 cut(s)	116, 355
BspANI	GGCC	3 cut(s)	175, 220, 647
BspCNI	CTCAG	4 cut(s)	149, 306, 321, 566
BspLI	GGNNCC	1 cut(s)	258
BspPI	GGATC	2 cut(s)	166, 360
BspT107I	GGYRCC	1 cut(s)	256
BsrGI	TGTACA	1 cut(s)	781
BsrI	ACTGG	1 cut(s)	468
BssECI	CCNNGG	1 cut(s)	252
BssMI	GATC	8 cut(s)	22, 83, 158, 292, 325, 365, 424, 545
BssNI	GRCGYC	2 cut(s)	119, 257
Bst2UI	CCWGG	3 cut(s)	172, 242, 254
Bst4CI	ACNGT	1 cut(s)	410
Bst6I	CTCTTC	1 cut(s)	103
BstACI	GRCGYC	2 cut(s)	119, 257
BstAUI	TGTACA	1 cut(s)	781
BstC8I	GCNNGC	1 cut(s)	267
BstDEI	CTNAG	4 cut(s)	136, 314, 329, 553
BstF5I	GGATG	2 cut(s)	339, 548
BstH2I	RGCGCY	1 cut(s)	260
BstHHI	GCGC	1 cut(s)	259
BstKTI	GATC	8 cut(s)	25, 86, 161, 295, 328, 368, 427, 548
BstMAI	GTCTC	3 cut(s)	378, 506, 728
BstMBI	GATC	8 cut(s)	22, 83, 158, 292, 325, 365, 424, 545
BstMCI	CGRYCG	1 cut(s)	18
BstMWI	GCNNNNNNNGC	3 cut(s)	53, 226, 256
BstNI	CCWGG	3 cut(s)	172, 242, 254
BstNSI	RCATGY	1 cut(s)	391
BstSCI	CCNGG	3 cut(s)	170, 240, 252
BstV1I	GCAGC	1 cut(s)	297
BstV2I	GAAGAC	1 cut(s)	531
BstX2I	RGATCY	4 cut(s)	158, 325, 365, 424
BstXI	CCANNNNNNTGG	1 cut(s)	241
BstYI	RGATCY	4 cut(s)	158, 325, 365, 424
BsuRI	GGCC	3 cut(s)	175, 220, 647
BtsCI	GGATG	2 cut(s)	339, 548
Cac8I	GCNNGC	1 cut(s)	267
CfoI	GCGC	1 cut(s)	259
Cfr13I	GGNCC	2 cut(s)	219, 645
CseI	GACGC	1 cut(s)	108
Csp6I	GTAC	2 cut(s)	627, 782
CviAII	CATG	3 cut(s)	223, 370, 388
CviQI	GTAC	2 cut(s)	627, 782
DdeI	CTNAG	4 cut(s)	136, 314, 329, 553
DinI	GGCGCC	1 cut(s)	258
DpnI	GATC	8 cut(s)	24, 85, 160, 294, 327, 367, 426, 547
DpnII	GATC	8 cut(s)	22, 83, 158, 292, 325, 365, 424, 545
EaeI	YGGCCR	1 cut(s)	173
Eam1104I	CTCTTC	1 cut(s)	103
EarI	CTCTTC	1 cut(s)	103
EciI	GGCGGA	1 cut(s)	370
Eco32I	GATATC	1 cut(s)	767
Eco57I	CTGAAG	2 cut(s)	449, 636
EcoRII	CCWGG	3 cut(s)	170, 240, 252
EcoRV	GATATC	1 cut(s)	767
EgeI	GGCGCC	1 cut(s)	258
EheI	GGCGCC	1 cut(s)	258
FaeI	CATG	3 cut(s)	226, 373, 391
FaiI	YATR	6 cut(s)	68, 80, 224, 371, 389, 757
FaqI	GGGAC	1 cut(s)	353
FatI	CATG	3 cut(s)	222, 369, 387
Fnu4HI	GCNGC	2 cut(s)	117, 311
FokI	GGATG	2 cut(s)	346, 535
Fsp4HI	GCNGC	2 cut(s)	117, 311
FspBI	CTAG	1 cut(s)	558
GlaI	GCGC	1 cut(s)	258
GluI	GCNGC	2 cut(s)	117, 311
GsuI	CTGGAG	1 cut(s)	485
HaeII	RGCGCY	1 cut(s)	260
HaeIII	GGCC	3 cut(s)	175, 220, 647
HapII	CCGG	1 cut(s)	18
HgaI	GACGC	1 cut(s)	108
HhaI	GCGC	1 cut(s)	259
Hin1I	GRCGYC	2 cut(s)	119, 257
Hin1II	CATG	3 cut(s)	226, 373, 391
Hin6I	GCGC	1 cut(s)	257
HinP1I	GCGC	1 cut(s)	257
HinfI	GANTC	4 cut(s)	10, 34, 144, 214
HpaII	CCGG	1 cut(s)	18
HphI	GGTGA	3 cut(s)	81, 449, 485
Hpy188I	TCNGA	7 cut(s)	15, 124, 330, 378, 429, 588, 733
Hpy188III	TCNNGA	3 cut(s)	202, 543, 661
Hpy99I	CGWCG	1 cut(s)	124
HpyAV	CCTTC	3 cut(s)	424, 531, 611
HpyCH4III	ACNGT	1 cut(s)	410
HpyCH4V	TGCA	2 cut(s)	265, 744
HpyF10VI	GCNNNNNNNGC	3 cut(s)	53, 226, 256
HpyF3I	CTNAG	4 cut(s)	136, 314, 329, 553
Hsp92I	GRCGYC	2 cut(s)	119, 257
Hsp92II	CATG	3 cut(s)	226, 373, 391
HspAI	GCGC	1 cut(s)	257
KasI	GGCGCC	1 cut(s)	256
Kzo9I	GATC	8 cut(s)	22, 83, 158, 292, 325, 365, 424, 545
LmnI	GCTCC	1 cut(s)	504
Lsp1109I	GCAGC	1 cut(s)	297
LweI	GCATC	1 cut(s)	65
MaeI	CTAG	1 cut(s)	558
MalI	GATC	8 cut(s)	24, 85, 160, 294, 327, 367, 426, 547
MboI	GATC	8 cut(s)	22, 83, 158, 292, 325, 365, 424, 545
MflI	RGATCY	4 cut(s)	158, 325, 365, 424
MluCI	AATT	3 cut(s)	638, 720, 738
Mly113I	GGCGCC	1 cut(s)	257
MmeI	TCCRAC	2 cut(s)	38, 102
MspI	CCGG	1 cut(s)	18
MspR9I	CCNGG	3 cut(s)	172, 242, 254
MvaI	CCWGG	3 cut(s)	172, 242, 254
MwoI	GCNNNNNNNGC	3 cut(s)	53, 226, 256
NarI	GGCGCC	1 cut(s)	257
NdeII	GATC	8 cut(s)	22, 83, 158, 292, 325, 365, 424, 545
NlaIII	CATG	3 cut(s)	226, 373, 391
NlaIV	GGNNCC	1 cut(s)	258
NspI	RCATGY	1 cut(s)	391
PfeI	GAWTC	4 cut(s)	10, 34, 144, 214
PkrI	GCNGC	2 cut(s)	118, 312
PluTI	GGCGCC	1 cut(s)	260
Psp6I	CCWGG	3 cut(s)	170, 240, 252
PspGI	CCWGG	3 cut(s)	170, 240, 252
PspN4I	GGNNCC	1 cut(s)	258
PspPI	GGNCC	2 cut(s)	219, 645
PsuI	RGATCY	4 cut(s)	158, 325, 365, 424
RsaI	GTAC	2 cut(s)	628, 783
RsaNI	GTAC	2 cut(s)	627, 782
SatI	GCNGC	2 cut(s)	117, 311
Sau3AI	GATC	8 cut(s)	22, 83, 158, 292, 325, 365, 424, 545
Sau96I	GGNCC	2 cut(s)	219, 645
ScaI	AGTACT	1 cut(s)	628
ScrFI	CCNGG	3 cut(s)	172, 242, 254
SfaNI	GCATC	1 cut(s)	65
SfoI	GGCGCC	1 cut(s)	258
SmlI	CTYRAG	1 cut(s)	661
SmoI	CTYRAG	1 cut(s)	661
Sse9I	AATT	3 cut(s)	638, 720, 738
SsiI	CCGC	2 cut(s)	116, 355
SspDI	GGCGCC	1 cut(s)	256
SspMI	CTAG	1 cut(s)	558
StyD4I	CCNGG	3 cut(s)	170, 240, 252
TaaI	ACNGT	1 cut(s)	410
TaqI	TCGA	6 cut(s)	25, 129, 142, 152, 300, 569
TasI	AATT	3 cut(s)	638, 720, 738
TatI	WGTACW	2 cut(s)	626, 781
TauI	GCSGC	1 cut(s)	119
TfiI	GAWTC	4 cut(s)	10, 34, 144, 214
TseI	GCWGC	1 cut(s)	310
TspDTI	ATGAA	1 cut(s)	239
XapI	RAATTY	1 cut(s)	638
XceI	RCATGY	1 cut(s)	391
XspI	CTAG	1 cut(s)	558
ZrmI	AGTACT	1 cut(s)	628

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.