Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002187.1

Orthogroup ID

OG0004849

Physical Location & Seq

Genomic Coordinates Reverse (-)

259323 .. 259654

Gene Structure 332 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002187.1_g000063.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 222 bp

atgtctaatgaacaaggaggaaatcaccagcccgccactgagggcgagaattctgctaccatccaacctaatgaggccaacaacgagagatatggggaaaagctgaccaaggatatcgcggaaacaaagaaaagccttcgcgagataaaccagcgaattgatcagaatgctcgggatgctaaagagcagatggagcagtttgagaaggaagccaggaagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

73

Amino Acids

8.37

Weight (kDa)

5.17

Isoelectric Point (pI)

32.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004849)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g28630
rosa_chinensis	RchiOBHm_Chr7g0195851
rosa_laevigata	RLG00000012332 RLG00000021565
rosa_multiflora	Rmu_co8209098.1_g000002 Rmu_sc0001551.1_g000016 Rmu_sc0002187.1_g000063 Rmu_sc0002187.1_g000066 Rmu_sc0002563.1_g000070 Rmu_sc0002717.1_g000010 Rmu_sc0003679.1_g000003 Rmu_sc0005003.1_g000005 Rmu_sc0005044.1_g000021 Rmu_sc0005044.1_g000023 Rmu_sc0005392.1_g000004 Rmu_sc0008245.1_g000018 Rmu_sc0008382.1_g000004 Rmu_sc0009227.1_g000002 Rmu_sc0017888.1_g000005
rosa_roxburghii	Rroxscaffold_176G00430960 Rroxscaffold_1G00004060 Rroxscaffold_6G00395070
rosa_samantha	Rh1CG420700 Rh1CG433300 Rh1DG437400 Rh2DG297400 Rh3AG107900 Rh3CG113700 Rh4CG269700 Rh5AG124400 Rh6AG162600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	119, 141
AciI	CCGC	2 cut(s)	33, 119
AcsI	RAATTY	1 cut(s)	49
AjnI	CCWGG	1 cut(s)	212
AluBI	AGCT	1 cut(s)	103
AluI	AGCT	1 cut(s)	103
Ama87I	CYCGRG	1 cut(s)	171
AoxI	GGCC	1 cut(s)	75
ApoI	RAATTY	1 cut(s)	49
AsuHPI	GGTGA	1 cut(s)	17
AvaI	CYCGRG	1 cut(s)	171
BccI	CCATC	2 cut(s)	68, 184
BcgI	CGANNNNNNTGC	2 cut(s)	35, 69
BciT130I	CCWGG	1 cut(s)	214
BclI	TGATCA	1 cut(s)	160
Bme1390I	CCNGG	1 cut(s)	214
BmeT110I	CYCGRG	1 cut(s)	171
BmrFI	CCNGG	1 cut(s)	214
BmsI	GCATC	1 cut(s)	166
BsaJI	CCNNGG	1 cut(s)	108
BseBI	CCWGG	1 cut(s)	214
BseDI	CCNNGG	1 cut(s)	108
BseGI	GGATG	2 cut(s)	60, 181
BseMII	CTCAG	1 cut(s)	30
Bsh1236I	CGCG	2 cut(s)	119, 141
BshFI	GGCC	1 cut(s)	77
BsiHKCI	CYCGRG	1 cut(s)	171
BsmI	GAATGC	1 cut(s)	172
BsnI	GGCC	1 cut(s)	77
BsoBI	CYCGRG	1 cut(s)	171
Bsp143I	GATC	1 cut(s)	160
Bsp68I	TCGCGA	1 cut(s)	141
BspACI	CCGC	2 cut(s)	33, 119
BspANI	GGCC	1 cut(s)	77
BspCNI	CTCAG	1 cut(s)	31
BspFNI	CGCG	2 cut(s)	119, 141
BssECI	CCNNGG	1 cut(s)	108
BssMI	GATC	1 cut(s)	160
BssT1I	CCWWGG	1 cut(s)	108
Bst2UI	CCWGG	1 cut(s)	214
BstC8I	GCNNGC	1 cut(s)	33
BstDEI	CTNAG	1 cut(s)	39
BstF5I	GGATG	2 cut(s)	60, 181
BstFNI	CGCG	2 cut(s)	119, 141
BstKTI	GATC	1 cut(s)	163
BstMBI	GATC	1 cut(s)	160
BstMWI	GCNNNNNNNGC	2 cut(s)	176, 193
BstNI	CCWGG	1 cut(s)	214
BstSCI	CCNGG	1 cut(s)	212
BstUI	CGCG	2 cut(s)	119, 141
BsuRI	GGCC	1 cut(s)	77
BtsCI	GGATG	2 cut(s)	60, 181
BtsIMutI	CAGTG	1 cut(s)	36
BtuMI	TCGCGA	1 cut(s)	141
Cac8I	GCNNGC	1 cut(s)	33
CviJI	RGCY	5 cut(s)	31, 77, 103, 135, 212
CviKI_1	RGCY	5 cut(s)	31, 77, 103, 135, 212
DdeI	CTNAG	1 cut(s)	39
DpnI	GATC	1 cut(s)	162
DpnII	GATC	1 cut(s)	160
Eco130I	CCWWGG	1 cut(s)	108
Eco32I	GATATC	1 cut(s)	115
Eco88I	CYCGRG	1 cut(s)	171
EcoRI	GAATTC	1 cut(s)	49
EcoRII	CCWGG	1 cut(s)	212
EcoRV	GATATC	1 cut(s)	115
EcoT14I	CCWWGG	1 cut(s)	108
ErhI	CCWWGG	1 cut(s)	108
FaiI	YATR	1 cut(s)	93
FauI	CCCGC	1 cut(s)	40
FbaI	TGATCA	1 cut(s)	160
FokI	GGATG	2 cut(s)	47, 188
HaeIII	GGCC	1 cut(s)	77
HphI	GGTGA	1 cut(s)	17
Hpy188I	TCNGA	1 cut(s)	165
Hpy188III	TCNNGA	2 cut(s)	140, 173
HpyAV	CCTTC	2 cut(s)	146, 199
HpyF10VI	GCNNNNNNNGC	2 cut(s)	176, 193
HpyF3I	CTNAG	1 cut(s)	39
Ksp22I	TGATCA	1 cut(s)	160
Kzo9I	GATC	1 cut(s)	160
LmnI	GCTCC	1 cut(s)	193
LpnPI	CCDG	3 cut(s)	41, 164, 199
LweI	GCATC	1 cut(s)	166
MalI	GATC	1 cut(s)	162
MboI	GATC	1 cut(s)	160
MluCI	AATT	2 cut(s)	49, 156
MmeI	TCCRAC	1 cut(s)	88
MnlI	CCTC	3 cut(s)	11, 34, 67
MspR9I	CCNGG	1 cut(s)	214
Mva1269I	GAATGC	1 cut(s)	172
MvaI	CCWGG	1 cut(s)	214
MvnI	CGCG	2 cut(s)	119, 141
MwoI	GCNNNNNNNGC	2 cut(s)	176, 193
NdeII	GATC	1 cut(s)	160
NruI	TCGCGA	1 cut(s)	141
PctI	GAATGC	1 cut(s)	172
Psp6I	CCWGG	1 cut(s)	212
PspGI	CCWGG	1 cut(s)	212
RruI	TCGCGA	1 cut(s)	141
Sau3AI	GATC	1 cut(s)	160
ScrFI	CCNGG	1 cut(s)	214
SetI	ASST	2 cut(s)	70, 105
SfaNI	GCATC	1 cut(s)	166
Sse9I	AATT	2 cut(s)	49, 156
SsiI	CCGC	2 cut(s)	33, 119
StyD4I	CCNGG	1 cut(s)	212
StyI	CCWWGG	1 cut(s)	108
TasI	AATT	2 cut(s)	49, 156
TscAI	CASTG	1 cut(s)	43
TspDTI	ATGAA	1 cut(s)	24
TspRI	CASTG	1 cut(s)	43
XapI	RAATTY	1 cut(s)	49

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.