Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017888.1

Orthogroup ID

OG0004849

Physical Location & Seq

Genomic Coordinates Reverse (-)

14942 .. 15865

Gene Structure 924 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017888.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 555 bp

atgggcaatgcttctgtcactggcgatactgctattgatgacgagttcgttcctctccccatcccagtgggtgcgagcgttgaggaacagctcgctatcctgaagatcaacagagataaatacgaggaaaatttggccaagtcgatcgcacagtcagagaaaaatcttcgcgatctggaccatctagaaactgcgcgtgaagatggtatttctgggattgaattgcctacaggtggcgatcaatctaagggcaaaaaccttcatctagatcagcccgttgcagaagaagaaactagcttgctcattggtgaatcacagccttacaagaggctgcttatggagaagatggggcaagatgcagcccatgttcattcctttgatcaacagaagcaagttcatgatcaatttaattgtgattcagttgctggacgtcatcatgatcatgcagaggaccaattaagtcttggtccacttaattataaatctagccttagccgtggtactggacatcatattgaagatggtcacattcatgaccaacttaagtatcaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

184

Amino Acids

20.38

Weight (kDa)

5.01

Isoelectric Point (pI)

51.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004849)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g28630
rosa_chinensis	RchiOBHm_Chr7g0195851
rosa_laevigata	RLG00000012332 RLG00000021565
rosa_multiflora	Rmu_co8209098.1_g000002 Rmu_sc0001551.1_g000016 Rmu_sc0002187.1_g000063 Rmu_sc0002187.1_g000066 Rmu_sc0002563.1_g000070 Rmu_sc0002717.1_g000010 Rmu_sc0003679.1_g000003 Rmu_sc0005003.1_g000005 Rmu_sc0005044.1_g000021 Rmu_sc0005044.1_g000023 Rmu_sc0005392.1_g000004 Rmu_sc0008245.1_g000018 Rmu_sc0008382.1_g000004 Rmu_sc0009227.1_g000002 Rmu_sc0017888.1_g000005
rosa_roxburghii	Rroxscaffold_176G00430960 Rroxscaffold_1G00004060 Rroxscaffold_6G00395070
rosa_samantha	Rh1CG420700 Rh1CG433300 Rh1DG437400 Rh2DG297400 Rh3AG107900 Rh3CG113700 Rh4CG269700 Rh5AG124400 Rh6AG162600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	480
AatII	GACGTC	1 cut(s)	433
AccII	CGCG	2 cut(s)	171, 196
AcoI	YGGCCR	1 cut(s)	135
AcsI	RAATTY	1 cut(s)	130
AcuI	CTGAAG	1 cut(s)	122
AcyI	GRCGYC	1 cut(s)	430
AfaI	GTAC	1 cut(s)	502
AfiI	CCNNNNNNNGG	1 cut(s)	233
AflII	CTTAAG	1 cut(s)	542
AgsI	TTSAA	2 cut(s)	221, 518
AluBI	AGCT	2 cut(s)	91, 297
AluI	AGCT	2 cut(s)	91, 297
AlwNI	CAGNNNCTG	1 cut(s)	425
AoxI	GGCC	1 cut(s)	135
ApeKI	GCWGC	2 cut(s)	331, 359
ApoI	RAATTY	1 cut(s)	130
AspLEI	GCGC	1 cut(s)	196
AspS9I	GGNCC	3 cut(s)	178, 451, 467
AsuHPI	GGTGA	1 cut(s)	320
AvaII	GGWCC	3 cut(s)	178, 451, 467
BaeI	ACNNNNGTAYC	1 cut(s)	530
BalI	TGGCCA	1 cut(s)	137
BbvI	GCAGC	2 cut(s)	318, 371
BccI	CCATC	5 cut(s)	68, 189, 197, 340, 515
BceAI	ACGGC	1 cut(s)	480
BclI	TGATCA	3 cut(s)	379, 400, 439
BfaI	CTAG	4 cut(s)	185, 266, 294, 486
BfmI	CTRYAG	1 cut(s)	228
BfrI	CTTAAG	1 cut(s)	542
BisI	GCNGC	2 cut(s)	332, 360
BlsI	GCNGC	2 cut(s)	333, 361
Bme18I	GGWCC	3 cut(s)	178, 451, 467
BmgT120I	GGNCC	3 cut(s)	178, 451, 467
BmrI	ACTGGG	1 cut(s)	59
BmsI	GCATC	1 cut(s)	346
BmuI	ACTGGG	1 cut(s)	59
Bpu10I	CCTNAGC	1 cut(s)	491
BsaHI	GRCGYC	1 cut(s)	430
BsaJI	CCNNGG	1 cut(s)	496
Bsc4I	CCNNNNNNNGG	1 cut(s)	233
Bse1I	ACTGG	3 cut(s)	25, 65, 508
Bse3DI	GCAATG	1 cut(s)	13
BseDI	CCNNGG	1 cut(s)	496
BseGI	GGATG	1 cut(s)	60
BseLI	CCNNNNNNNGG	1 cut(s)	233
BseMI	GCAATG	1 cut(s)	13
BseNI	ACTGG	3 cut(s)	25, 65, 508
BseXI	GCAGC	2 cut(s)	318, 371
Bsh1236I	CGCG	2 cut(s)	171, 196
Bsh1285I	CGRYCG	1 cut(s)	147
BshFI	GGCC	1 cut(s)	137
BsiEI	CGRYCG	1 cut(s)	147
BslI	CCNNNNNNNGG	1 cut(s)	233
BsnI	GGCC	1 cut(s)	137
Bsp143I	GATC	8 cut(s)	105, 144, 172, 238, 268, 379, 400, 439
Bsp68I	TCGCGA	1 cut(s)	171
BspANI	GGCC	1 cut(s)	137
BspFNI	CGCG	2 cut(s)	171, 196
BspHI	TCATGA	3 cut(s)	397, 436, 532
BspTI	CTTAAG	1 cut(s)	542
BsrDI	GCAATG	1 cut(s)	13
BsrI	ACTGG	3 cut(s)	25, 65, 508
BssECI	CCNNGG	1 cut(s)	496
BssMI	GATC	8 cut(s)	105, 144, 172, 238, 268, 379, 400, 439
BssNI	GRCGYC	1 cut(s)	430
Bst4CI	ACNGT	1 cut(s)	153
BstACI	GRCGYC	1 cut(s)	430
BstAFI	CTTAAG	1 cut(s)	542
BstC8I	GCNNGC	3 cut(s)	76, 93, 299
BstDEI	CTNAG	2 cut(s)	246, 491
BstDSI	CCRYGG	1 cut(s)	496
BstF5I	GGATG	1 cut(s)	60
BstFNI	CGCG	2 cut(s)	171, 196
BstHHI	GCGC	1 cut(s)	196
BstKTI	GATC	8 cut(s)	108, 147, 175, 241, 271, 382, 403, 442
BstMBI	GATC	8 cut(s)	105, 144, 172, 238, 268, 379, 400, 439
BstMCI	CGRYCG	1 cut(s)	147
BstSFI	CTRYAG	1 cut(s)	228
BstUI	CGCG	2 cut(s)	171, 196
BstV1I	GCAGC	2 cut(s)	318, 371
BstXI	CCANNNNNNTGG	1 cut(s)	67
BsuRI	GGCC	1 cut(s)	137
BtgI	CCRYGG	1 cut(s)	496
BtsCI	GGATG	1 cut(s)	60
BtsIMutI	CAGTG	2 cut(s)	18, 72
BtuMI	TCGCGA	1 cut(s)	171
Cac8I	GCNNGC	3 cut(s)	76, 93, 299
CaiI	CAGNNNCTG	1 cut(s)	425
CciI	TCATGA	3 cut(s)	397, 436, 532
CfoI	GCGC	1 cut(s)	196
Cfr13I	GGNCC	3 cut(s)	178, 451, 467
Csp6I	GTAC	1 cut(s)	501
CviAII	CATG	5 cut(s)	365, 398, 437, 443, 533
CviJI	RGCY	9 cut(s)	91, 137, 274, 297, 319, 331, 362, 489, 495
CviKI_1	RGCY	9 cut(s)	91, 137, 274, 297, 319, 331, 362, 489, 495
CviQI	GTAC	1 cut(s)	501
DdeI	CTNAG	2 cut(s)	246, 491
DpnI	GATC	8 cut(s)	107, 146, 174, 240, 270, 381, 402, 441
DpnII	GATC	8 cut(s)	105, 144, 172, 238, 268, 379, 400, 439
EaeI	YGGCCR	1 cut(s)	135
Eco47I	GGWCC	3 cut(s)	178, 451, 467
Eco57I	CTGAAG	1 cut(s)	122
FaeI	CATG	5 cut(s)	368, 401, 440, 446, 536
FaiI	YATR	8 cut(s)	338, 366, 399, 438, 444, 480, 513, 534
FatI	CATG	5 cut(s)	364, 397, 436, 442, 532
FbaI	TGATCA	3 cut(s)	379, 400, 439
Fnu4HI	GCNGC	2 cut(s)	332, 360
FokI	GGATG	1 cut(s)	47
Fsp4HI	GCNGC	2 cut(s)	332, 360
FspBI	CTAG	4 cut(s)	185, 266, 294, 486
GlaI	GCGC	1 cut(s)	195
GluI	GCNGC	2 cut(s)	332, 360
HaeIII	GGCC	1 cut(s)	137
HhaI	GCGC	1 cut(s)	196
Hin1I	GRCGYC	1 cut(s)	430
Hin1II	CATG	5 cut(s)	368, 401, 440, 446, 536
Hin6I	GCGC	1 cut(s)	194
HinP1I	GCGC	1 cut(s)	194
HinfI	GANTC	2 cut(s)	311, 416
HphI	GGTGA	1 cut(s)	320
Hpy166II	GTNNAC	1 cut(s)	470
Hpy188I	TCNGA	1 cut(s)	157
Hpy188III	TCNNGA	8 cut(s)	100, 170, 176, 185, 266, 398, 437, 533
Hpy8I	GTNNAC	1 cut(s)	470
HpyAV	CCTTC	1 cut(s)	269
HpyCH4III	ACNGT	1 cut(s)	153
HpyCH4IV	ACGT	1 cut(s)	430
HpyCH4V	TGCA	3 cut(s)	281, 359, 446
HpyF3I	CTNAG	2 cut(s)	246, 491
HpySE526I	ACGT	1 cut(s)	430
Hsp92I	GRCGYC	1 cut(s)	430
Hsp92II	CATG	5 cut(s)	368, 401, 440, 446, 536
HspAI	GCGC	1 cut(s)	194
Ksp22I	TGATCA	3 cut(s)	379, 400, 439
Kzo9I	GATC	8 cut(s)	105, 144, 172, 238, 268, 379, 400, 439
LpnPI	CCDG	8 cut(s)	6, 78, 113, 161, 198, 216, 411, 489
Lsp1109I	GCAGC	2 cut(s)	318, 371
LweI	GCATC	1 cut(s)	346
MaeI	CTAG	4 cut(s)	185, 266, 294, 486
MaeII	ACGT	1 cut(s)	430
MaeIII	GTNAC	2 cut(s)	16, 524
MalI	GATC	8 cut(s)	107, 146, 174, 240, 270, 381, 402, 441
MboI	GATC	8 cut(s)	105, 144, 172, 238, 268, 379, 400, 439
MboII	GAAGA	7 cut(s)	115, 158, 212, 296, 299, 355, 530
MlsI	TGGCCA	1 cut(s)	137
MluCI	AATT	6 cut(s)	130, 221, 404, 409, 455, 475
MluNI	TGGCCA	1 cut(s)	137
MnlI	CCTC	5 cut(s)	63, 76, 118, 321, 442
Mox20I	TGGCCA	1 cut(s)	137
MscI	TGGCCA	1 cut(s)	137
MseI	TTAA	4 cut(s)	408, 458, 474, 543
MslI	CAYNNNNRTG	3 cut(s)	65, 441, 531
Msp20I	TGGCCA	1 cut(s)	137
MspCI	CTTAAG	1 cut(s)	542
MvnI	CGCG	2 cut(s)	171, 196
NdeII	GATC	8 cut(s)	105, 144, 172, 238, 268, 379, 400, 439
NlaIII	CATG	5 cut(s)	368, 401, 440, 446, 536
NmuCI	GTSAC	2 cut(s)	16, 524
NruI	TCGCGA	1 cut(s)	171
PagI	TCATGA	3 cut(s)	397, 436, 532
PfeI	GAWTC	2 cut(s)	311, 416
PkrI	GCNGC	2 cut(s)	333, 361
Ple19I	CGATCG	1 cut(s)	147
PsiI	TTATAA	1 cut(s)	480
PspPI	GGNCC	3 cut(s)	178, 451, 467
PstNI	CAGNNNCTG	1 cut(s)	425
PvuI	CGATCG	1 cut(s)	147
RruI	TCGCGA	1 cut(s)	171
RsaI	GTAC	1 cut(s)	502
RsaNI	GTAC	1 cut(s)	501
RseI	CAYNNNNRTG	3 cut(s)	65, 441, 531
SaqAI	TTAA	4 cut(s)	408, 458, 474, 543
SatI	GCNGC	2 cut(s)	332, 360
Sau3AI	GATC	8 cut(s)	105, 144, 172, 238, 268, 379, 400, 439
Sau96I	GGNCC	3 cut(s)	178, 451, 467
SetI	ASST	5 cut(s)	93, 235, 261, 299, 433
SfaNI	GCATC	1 cut(s)	346
SfcI	CTRYAG	1 cut(s)	228
SinI	GGWCC	3 cut(s)	178, 451, 467
SmiMI	CAYNNNNRTG	3 cut(s)	65, 441, 531
SmlI	CTYRAG	1 cut(s)	542
SmoI	CTYRAG	1 cut(s)	542
Sse9I	AATT	6 cut(s)	130, 221, 404, 409, 455, 475
SspMI	CTAG	4 cut(s)	185, 266, 294, 486
TaaI	ACNGT	1 cut(s)	153
TaiI	ACGT	1 cut(s)	433
TaqI	TCGA	1 cut(s)	143
TasI	AATT	6 cut(s)	130, 221, 404, 409, 455, 475
TfiI	GAWTC	2 cut(s)	311, 416
Tru1I	TTAA	4 cut(s)	408, 458, 474, 543
Tru9I	TTAA	4 cut(s)	408, 458, 474, 543
TscAI	CASTG	2 cut(s)	25, 72
TseFI	GTSAC	2 cut(s)	16, 524
TseI	GCWGC	2 cut(s)	331, 359
Tsp45I	GTSAC	2 cut(s)	16, 524
TspDTI	ATGAA	4 cut(s)	251, 359, 386, 521
TspRI	CASTG	2 cut(s)	25, 72
Vha464I	CTTAAG	1 cut(s)	542
VpaK11BI	GGWCC	3 cut(s)	178, 451, 467
XapI	RAATTY	1 cut(s)	130
XbaI	TCTAGA	2 cut(s)	184, 265
XcmI	CCANNNNNNNNNTGG	1 cut(s)	461
XspI	CTAG	4 cut(s)	185, 266, 294, 486
ZraI	GACGTC	1 cut(s)	431

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.