Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008245.1

Orthogroup ID

OG0004849

Physical Location & Seq

Genomic Coordinates Reverse (-)

35031 .. 35414

Gene Structure 384 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008245.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 384 bp

atgtcaactgagcagggcataaatcagccgcccgctactgagggtgaaagttcggctactatctcaacgagcgaagtagtcaatactcccgtgactactgtggccgccacggctggccagacaactgaagctagcgagttcgaagccctcatcatcccagaggatgctagcattgatgagcgactctgcatccttacggtcaacagcgacaattatcggagacagttggctgcttcgatcactaggacggaacaacgtctgcatgattttgatcagcgaatgaagcggaatgcccaggaggccaaagagcatgcacgacaccttgctaatgaggccaaagtgcatgccgataagattgtcgacaataaccttgcacaatactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

127

Amino Acids

13.99

Weight (kDa)

4.9

Isoelectric Point (pI)

41.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004849)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g28630
rosa_chinensis	RchiOBHm_Chr7g0195851
rosa_laevigata	RLG00000012332 RLG00000021565
rosa_multiflora	Rmu_co8209098.1_g000002 Rmu_sc0001551.1_g000016 Rmu_sc0002187.1_g000063 Rmu_sc0002187.1_g000066 Rmu_sc0002563.1_g000070 Rmu_sc0002717.1_g000010 Rmu_sc0003679.1_g000003 Rmu_sc0005003.1_g000005 Rmu_sc0005044.1_g000021 Rmu_sc0005044.1_g000023 Rmu_sc0005392.1_g000004 Rmu_sc0008245.1_g000018 Rmu_sc0008382.1_g000004 Rmu_sc0009227.1_g000002 Rmu_sc0017888.1_g000005
rosa_roxburghii	Rroxscaffold_176G00430960 Rroxscaffold_1G00004060 Rroxscaffold_6G00395070
rosa_samantha	Rh1CG420700 Rh1CG433300 Rh1DG437400 Rh2DG297400 Rh3AG107900 Rh3CG113700 Rh4CG269700 Rh5AG124400 Rh6AG162600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	360
AciI	CCGC	4 cut(s)	29, 33, 105, 286
AcoI	YGGCCR	2 cut(s)	102, 115
AcuI	CTGAAG	1 cut(s)	147
AjnI	CCWGG	1 cut(s)	294
AluBI	AGCT	1 cut(s)	131
AluI	AGCT	1 cut(s)	131
Alw26I	GTCTC	1 cut(s)	214
AoxI	GGCC	4 cut(s)	102, 115, 300, 333
ApeKI	GCWGC	1 cut(s)	230
AsuHPI	GGTGA	1 cut(s)	56
AsuII	TTCGAA	1 cut(s)	141
AsuNHI	GCTAGC	2 cut(s)	131, 167
BalI	TGGCCA	1 cut(s)	117
BbvI	GCAGC	1 cut(s)	217
BceAI	ACGGC	1 cut(s)	126
BciT130I	CCWGG	1 cut(s)	296
BclI	TGATCA	1 cut(s)	271
BcoDI	GTCTC	1 cut(s)	214
BfaI	CTAG	4 cut(s)	132, 168, 243, 382
BglI	GCCNNNNNGGC	2 cut(s)	110, 299
BisI	GCNGC	3 cut(s)	29, 105, 231
BlsI	GCNGC	3 cut(s)	30, 106, 232
Bme1390I	CCNGG	1 cut(s)	296
BmrFI	CCNGG	1 cut(s)	296
BmsI	GCATC	2 cut(s)	154, 198
BmtI	GCTAGC	2 cut(s)	135, 171
Bpu14I	TTCGAA	1 cut(s)	141
BsaBI	GATNNNNATC	1 cut(s)	270
BsaJI	CCNNGG	2 cut(s)	108, 294
Bse8I	GATNNNNATC	1 cut(s)	270
BseBI	CCWGG	1 cut(s)	296
BseDI	CCNNGG	2 cut(s)	108, 294
BseGI	GGATG	3 cut(s)	153, 169, 189
BseJI	GATNNNNATC	1 cut(s)	270
BseMII	CTCAG	1 cut(s)	30
BseXI	GCAGC	1 cut(s)	217
BshFI	GGCC	4 cut(s)	104, 117, 302, 335
BsmAI	GTCTC	1 cut(s)	214
BsmI	GAATGC	1 cut(s)	295
BsnI	GGCC	4 cut(s)	104, 117, 302, 335
Bsp119I	TTCGAA	1 cut(s)	141
Bsp143I	GATC	2 cut(s)	237, 271
BspACI	CCGC	4 cut(s)	29, 33, 105, 286
BspANI	GGCC	4 cut(s)	104, 117, 302, 335
BspCNI	CTCAG	1 cut(s)	31
BspOI	GCTAGC	2 cut(s)	135, 171
BspT104I	TTCGAA	1 cut(s)	141
BssECI	CCNNGG	2 cut(s)	108, 294
BssMI	GATC	2 cut(s)	237, 271
Bst2UI	CCWGG	1 cut(s)	296
Bst4CI	ACNGT	3 cut(s)	100, 199, 225
BstBI	TTCGAA	1 cut(s)	141
BstC8I	GCNNGC	6 cut(s)	33, 115, 133, 169, 312, 345
BstDEI	CTNAG	2 cut(s)	9, 39
BstDSI	CCRYGG	1 cut(s)	108
BstF5I	GGATG	3 cut(s)	153, 169, 189
BstKTI	GATC	2 cut(s)	240, 274
BstMAI	GTCTC	1 cut(s)	214
BstMBI	GATC	2 cut(s)	237, 271
BstMWI	GCNNNNNNNGC	4 cut(s)	110, 283, 299, 332
BstNI	CCWGG	1 cut(s)	296
BstNSI	RCATGY	2 cut(s)	314, 347
BstSCI	CCNGG	1 cut(s)	294
BstV1I	GCAGC	1 cut(s)	217
BsuRI	GGCC	4 cut(s)	104, 117, 302, 335
BtgI	CCRYGG	1 cut(s)	108
BtsCI	GGATG	3 cut(s)	153, 169, 189
Cac8I	GCNNGC	6 cut(s)	33, 115, 133, 169, 312, 345
CviAII	CATG	3 cut(s)	263, 311, 344
DdeI	CTNAG	2 cut(s)	9, 39
DpnI	GATC	2 cut(s)	239, 273
DpnII	GATC	2 cut(s)	237, 271
EaeI	YGGCCR	2 cut(s)	102, 115
Eco57I	CTGAAG	1 cut(s)	147
EcoRII	CCWGG	1 cut(s)	294
FaeI	CATG	3 cut(s)	266, 314, 347
FaiI	YATR	4 cut(s)	20, 264, 312, 345
FatI	CATG	3 cut(s)	262, 310, 343
FauI	CCCGC	1 cut(s)	40
FbaI	TGATCA	1 cut(s)	271
FblI	GTMKAC	1 cut(s)	360
Fnu4HI	GCNGC	3 cut(s)	29, 105, 231
FokI	GGATG	3 cut(s)	140, 176, 176
Fsp4HI	GCNGC	3 cut(s)	29, 105, 231
FspBI	CTAG	4 cut(s)	132, 168, 243, 382
GluI	GCNGC	3 cut(s)	29, 105, 231
HaeIII	GGCC	4 cut(s)	104, 117, 302, 335
Hin1II	CATG	3 cut(s)	266, 314, 347
HincII	GTYRAC	3 cut(s)	6, 202, 361
HindII	GTYRAC	3 cut(s)	6, 202, 361
HinfI	GANTC	1 cut(s)	183
HphI	GGTGA	1 cut(s)	56
Hpy166II	GTNNAC	3 cut(s)	6, 202, 361
Hpy188I	TCNGA	1 cut(s)	219
Hpy8I	GTNNAC	3 cut(s)	6, 202, 361
HpyCH4III	ACNGT	3 cut(s)	100, 199, 225
HpyCH4IV	ACGT	1 cut(s)	256
HpyCH4V	TGCA	5 cut(s)	189, 262, 314, 343, 374
HpyF10VI	GCNNNNNNNGC	4 cut(s)	110, 283, 299, 332
HpyF3I	CTNAG	2 cut(s)	9, 39
HpySE526I	ACGT	1 cut(s)	256
Hsp92II	CATG	3 cut(s)	266, 314, 347
Ksp22I	TGATCA	1 cut(s)	271
Kzo9I	GATC	2 cut(s)	237, 271
LpnPI	CCDG	5 cut(s)	99, 131, 171, 281, 308
Lsp1109I	GCAGC	1 cut(s)	217
LweI	GCATC	2 cut(s)	154, 198
MaeI	CTAG	4 cut(s)	132, 168, 243, 382
MaeII	ACGT	1 cut(s)	256
MaeIII	GTNAC	1 cut(s)	91
MalI	GATC	2 cut(s)	239, 273
MboI	GATC	2 cut(s)	237, 271
MlsI	TGGCCA	1 cut(s)	117
MluCI	AATT	1 cut(s)	211
MluNI	TGGCCA	1 cut(s)	117
MlyI	GAGTC	1 cut(s)	177
MnlI	CCTC	5 cut(s)	34, 154, 158, 292, 325
Mox20I	TGGCCA	1 cut(s)	117
MscI	TGGCCA	1 cut(s)	117
Msp20I	TGGCCA	1 cut(s)	117
MspR9I	CCNGG	1 cut(s)	296
Mva1269I	GAATGC	1 cut(s)	295
MvaI	CCWGG	1 cut(s)	296
MwoI	GCNNNNNNNGC	4 cut(s)	110, 283, 299, 332
NdeII	GATC	2 cut(s)	237, 271
NheI	GCTAGC	2 cut(s)	131, 167
NlaIII	CATG	3 cut(s)	266, 314, 347
NmuCI	GTSAC	1 cut(s)	91
NspI	RCATGY	2 cut(s)	314, 347
NspV	TTCGAA	1 cut(s)	141
PaeI	GCATGC	2 cut(s)	314, 347
PctI	GAATGC	1 cut(s)	295
PkrI	GCNGC	3 cut(s)	30, 106, 232
PleI	GAGTC	1 cut(s)	177
PpsI	GAGTC	1 cut(s)	177
Psp6I	CCWGG	1 cut(s)	294
PspGI	CCWGG	1 cut(s)	294
SalI	GTCGAC	1 cut(s)	359
SatI	GCNGC	3 cut(s)	29, 105, 231
Sau3AI	GATC	2 cut(s)	237, 271
SchI	GAGTC	1 cut(s)	177
ScrFI	CCNGG	1 cut(s)	296
SetI	ASST	4 cut(s)	133, 259, 324, 372
SfaNI	GCATC	2 cut(s)	154, 198
SfuI	TTCGAA	1 cut(s)	141
SphI	GCATGC	2 cut(s)	314, 347
Sse9I	AATT	1 cut(s)	211
SsiI	CCGC	4 cut(s)	29, 33, 105, 286
SspMI	CTAG	4 cut(s)	132, 168, 243, 382
StyD4I	CCNGG	1 cut(s)	294
TaaI	ACNGT	3 cut(s)	100, 199, 225
TaiI	ACGT	1 cut(s)	259
TaqI	TCGA	3 cut(s)	141, 236, 360
TasI	AATT	1 cut(s)	211
TauI	GCSGC	2 cut(s)	31, 107
TseFI	GTSAC	1 cut(s)	91
TseI	GCWGC	1 cut(s)	230
Tsp45I	GTSAC	1 cut(s)	91
TspDTI	ATGAA	1 cut(s)	296
TspGWI	ACGGA	1 cut(s)	263
XceI	RCATGY	2 cut(s)	314, 347
XmiI	GTMKAC	1 cut(s)	360
XspI	CTAG	4 cut(s)	132, 168, 243, 382

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.