Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003629.1

Orthogroup ID

OG0004545

Physical Location & Seq

Genomic Coordinates Reverse (-)

306127 .. 307281

Gene Structure 1155 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003629.1_g000070.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1155 bp

atgcactttgcacaagcagaggcctatcccatggtccgaccttggggaccaacacgggtgtcaagaaccctttacttggttgaacctgaagatgacttcagtttggctataaaggacaaggactatttgtccgattgtgactatggctcattgaagtttgacaagtgtcatttccgcatgaatcttgccaaatataaattaccattgcgggatgctgagaaggtaatgaataatgatgataatgtcaatctgatgcgtaataggaaacatggctctaaaaggatgccttgcatcaagattaggcccaacgatcacaaatacaatgtggtgaattcgtgcaacggcttcctttgtttgtctgaaccaatttttaatgacccagttgttgtctgcaaccctgtaacaggagagtttatgcaccttcctgaaacttctaagcgggagaaccaaaaggttaccatccattgcggaattggtttcagtccaaaagctaacagatataaggtggtgcgaatctttgatcaagggtcacctcatcctattacgatcgctgaggtacacactcttgggtcaagttcatggaagctcattggtagttgtccctgctcatcatataaccagctagcgttccccacctatattgaaggagcactttattggttttactatgatcctttaaaatatgtcatactttcatttgacttggacagtgagaacttccaatcacttccaccactgccttttcaacgagagcaatatcgtaatgtgagcatgggagttttgggaaattgcctttgtgtctgtgatgctcatggtattcatatcaatttgtgggtactgaaaaatcatggtgcaaaaagatcttggaggaggaagatttctattgaaacagatcattttgggtttgatggtgaaaggtggccttctggcttatataaaccaatgaaatactgtaaggatgagggcttgttgatgtttaactatcgtactaacgcgttgatttaccatcatccaaaaacccacagatttatttatctcaagcttcgtggcatcaagtcaaatttttcagctatcagtcatgttccaagctttatttcactcaaggacattttggtgggggatgatgtcaacatactgaatataaattcgaggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBA_1

Protein Analysis

384

Amino Acids

44.37

Weight (kDa)

8.96

Isoelectric Point (pI)

42.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004545)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g27870 FvH4_6g28330
malus_domestica	MD01G1181800.v1.1 MD17G1263300.v1.1
prunus_persica	Prupe.3G111700_v2.0.a1 Prupe.3G112000_v2.0.a1 Prupe.3G112200_v2.0.a1 Prupe.3G112200_v2.0.a1 Prupe.3G112400_v2.0.a1 Prupe.3G112400_v2.0.a1
pyrus_communis	pycom17g26350
rosa_chinensis	RchiOBHm_Chr2g0131131
rosa_laevigata	RLG00000019173 RLG00000019176
rosa_multiflora	Rmu_sc0003629.1_g000070
rosa_roxburghii	Rroxscaffold_2G00113130
rosa_rugosa	Rorug02G0327300
rosa_samantha	Rh2AG347600 Rh2AG348000 Rh2BG355200 Rh2BG355300 Rh2CG333800 Rh2CG333900 Rh2CG334000 Rh2CG335100 Rh2DG373000 Rh2DG373300 Rh2DG374100
rosa_wichuraiana	Rw2G028230 Rw2G028250 Rw2G028280 Rw2G028310

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	995
AciI	CCGC	4 cut(s)	175, 208, 439, 468
AclWI	GGATC	1 cut(s)	665
AcsI	RAATTY	3 cut(s)	331, 1060, 1144
AcuI	CTGAAG	2 cut(s)	82, 108
AfaI	GTAC	3 cut(s)	558, 837, 988
AfiI	CCNNNNNNNGG	3 cut(s)	43, 76, 404
AflIII	ACRYGT	1 cut(s)	993
AgsI	TTSAA	5 cut(s)	83, 154, 644, 746, 887
AhdI	GACNNNNNGTC	1 cut(s)	127
AjuI	GAANNNNNNNTTGG	2 cut(s)	1078, 1110
AluBI	AGCT	6 cut(s)	491, 586, 622, 1042, 1070, 1089
AluI	AGCT	6 cut(s)	491, 586, 622, 1042, 1070, 1089
Alw21I	GWGCWC	1 cut(s)	652
AlwI	GGATC	1 cut(s)	665
AoxI	GGCC	3 cut(s)	21, 302, 920
ApoI	RAATTY	3 cut(s)	331, 1060, 1144
AspS9I	GGNCC	3 cut(s)	34, 47, 303
AsuHPI	GGTGA	3 cut(s)	340, 522, 923
AsuNHI	GCTAGC	1 cut(s)	622
AvaII	GGWCC	2 cut(s)	34, 47
Bbv12I	GWGCWC	1 cut(s)	652
BbvCI	CCTCAGC	1 cut(s)	552
BccI	CCATC	3 cut(s)	467, 902, 1014
BceAI	ACGGC	1 cut(s)	358
BclI	TGATCA	1 cut(s)	520
BfaI	CTAG	1 cut(s)	623
BglII	AGATCT	1 cut(s)	860
Bme18I	GGWCC	2 cut(s)	34, 47
BmeRI	GACNNNNNGTC	1 cut(s)	127
BmgT120I	GGNCC	3 cut(s)	34, 47, 303
BmiI	GGNNCC	1 cut(s)	48
BmrI	ACTGGG	1 cut(s)	374
BmsI	GCATC	6 cut(s)	202, 243, 273, 300, 796, 1059
BmtI	GCTAGC	1 cut(s)	626
BmuI	ACTGGG	1 cut(s)	374
BoxI	GACNNNNGTC	1 cut(s)	165
Bpu10I	CCTNAGC	1 cut(s)	552
BpuEI	CTTGAG	2 cut(s)	1022, 1085
BsaJI	CCNNGG	2 cut(s)	30, 41
Bsc4I	CCNNNNNNNGG	3 cut(s)	43, 76, 404
Bse1I	ACTGG	1 cut(s)	380
Bse3DI	GCAATG	2 cut(s)	203, 463
BseDI	CCNNGG	2 cut(s)	30, 41
BseGI	GGATG	7 cut(s)	217, 288, 459, 535, 964, 1009, 1126
BseLI	CCNNNNNNNGG	3 cut(s)	43, 76, 404
BseMI	GCAATG	2 cut(s)	203, 463
BseMII	CTCAG	2 cut(s)	207, 543
BseNI	ACTGG	1 cut(s)	380
BseRI	GAGGAG	1 cut(s)	883
Bsh1236I	CGCG	1 cut(s)	995
Bsh1285I	CGRYCG	1 cut(s)	549
BshFI	GGCC	3 cut(s)	23, 304, 922
BsiEI	CGRYCG	1 cut(s)	549
BsiHKAI	GWGCWC	1 cut(s)	652
BslFI	GGGAC	2 cut(s)	60, 585
BslI	CCNNNNNNNGG	3 cut(s)	43, 76, 404
BsmFI	GGGAC	2 cut(s)	60, 585
BsnI	GGCC	3 cut(s)	23, 304, 922
Bsp1286I	GDGCHC	1 cut(s)	652
Bsp143I	GATC	6 cut(s)	310, 520, 546, 670, 860, 892
Bsp19I	CCATGG	1 cut(s)	30
BspACI	CCGC	4 cut(s)	175, 208, 439, 468
BspANI	GGCC	3 cut(s)	23, 304, 922
BspCNI	CTCAG	2 cut(s)	208, 544
BspFNI	CGCG	1 cut(s)	995
BspLI	GGNNCC	1 cut(s)	48
BspOI	GCTAGC	1 cut(s)	626
BspPI	GGATC	1 cut(s)	665
BsrDI	GCAATG	2 cut(s)	203, 463
BsrI	ACTGG	1 cut(s)	380
BssECI	CCNNGG	2 cut(s)	30, 41
BssMI	GATC	6 cut(s)	310, 520, 546, 670, 860, 892
BssT1I	CCWWGG	2 cut(s)	30, 41
Bst4CI	ACNGT	2 cut(s)	710, 953
BstC8I	GCNNGC	1 cut(s)	624
BstDEI	CTNAG	3 cut(s)	216, 435, 552
BstDSI	CCRYGG	1 cut(s)	30
BstEII	GGTNACC	2 cut(s)	454, 528
BstENI	CCTNNNNNAGG	1 cut(s)	402
BstF5I	GGATG	7 cut(s)	217, 288, 459, 535, 964, 1009, 1126
BstFNI	CGCG	1 cut(s)	995
BstKTI	GATC	6 cut(s)	313, 523, 549, 673, 863, 895
BstMBI	GATC	6 cut(s)	310, 520, 546, 670, 860, 892
BstMCI	CGRYCG	1 cut(s)	549
BstPAI	GACNNNNGTC	1 cut(s)	165
BstPI	GGTNACC	2 cut(s)	454, 528
BstUI	CGCG	1 cut(s)	995
BstX2I	RGATCY	1 cut(s)	860
BstYI	RGATCY	1 cut(s)	860
BsuRI	GGCC	3 cut(s)	23, 304, 922
BtgI	CCRYGG	1 cut(s)	30
BtsCI	GGATG	7 cut(s)	217, 288, 459, 535, 964, 1009, 1126
BtsI	GCAGTG	1 cut(s)	734
BtsIMutI	CAGTG	2 cut(s)	715, 734
Cac8I	GCNNGC	1 cut(s)	624
Cfr13I	GGNCC	3 cut(s)	34, 47, 303
Csp6I	GTAC	3 cut(s)	557, 836, 987
CspCI	CAANNNNNGTGG	4 cut(s)	622, 657, 1027, 1062
CviAII	CATG	8 cut(s)	31, 178, 269, 579, 772, 812, 848, 1079
CviQI	GTAC	3 cut(s)	557, 836, 987
DdeI	CTNAG	3 cut(s)	216, 435, 552
DpnI	GATC	6 cut(s)	312, 522, 548, 672, 862, 894
DpnII	GATC	6 cut(s)	310, 520, 546, 670, 860, 892
DraI	TTTAAA	1 cut(s)	678
DriI	GACNNNNNGTC	1 cut(s)	127
Eam1105I	GACNNNNNGTC	1 cut(s)	127
Eco130I	CCWWGG	2 cut(s)	30, 41
Eco147I	AGGCCT	1 cut(s)	23
Eco47I	GGWCC	2 cut(s)	34, 47
Eco57I	CTGAAG	2 cut(s)	82, 108
Eco91I	GGTNACC	2 cut(s)	454, 528
EcoNI	CCTNNNNNAGG	1 cut(s)	402
EcoO65I	GGTNACC	2 cut(s)	454, 528
EcoRI	GAATTC	1 cut(s)	331
EcoT14I	CCWWGG	2 cut(s)	30, 41
ErhI	CCWWGG	2 cut(s)	30, 41
FaeI	CATG	8 cut(s)	34, 181, 272, 582, 775, 815, 851, 1082
FalI	AAGNNNNNCTT	6 cut(s)	271, 303, 636, 668, 907, 939
FaqI	GGGAC	2 cut(s)	60, 585
FatI	CATG	8 cut(s)	30, 177, 268, 578, 771, 811, 847, 1078
FauI	CCCGC	2 cut(s)	201, 432
FbaI	TGATCA	1 cut(s)	520
FokI	GGATG	7 cut(s)	224, 295, 446, 522, 971, 996, 1133
FspBI	CTAG	1 cut(s)	623
HaeIII	GGCC	3 cut(s)	23, 304, 922
Hin1II	CATG	8 cut(s)	34, 181, 272, 582, 775, 815, 851, 1082
HincII	GTYRAC	1 cut(s)	1129
HindII	GTYRAC	1 cut(s)	1129
HindIII	AAGCTT	2 cut(s)	1040, 1087
HinfI	GANTC	2 cut(s)	181, 513
HphI	GGTGA	3 cut(s)	340, 522, 923
Hpy166II	GTNNAC	2 cut(s)	559, 1129
Hpy188I	TCNGA	4 cut(s)	38, 133, 252, 361
Hpy188III	TCNNGA	3 cut(s)	63, 295, 425
Hpy8I	GTNNAC	2 cut(s)	559, 1129
HpyAV	CCTTC	4 cut(s)	214, 431, 638, 933
HpyCH4III	ACNGT	2 cut(s)	710, 953
HpyCH4V	TGCA	7 cut(s)	4, 11, 291, 339, 393, 418, 854
HpyF3I	CTNAG	3 cut(s)	216, 435, 552
Hsp92II	CATG	8 cut(s)	34, 181, 272, 582, 775, 815, 851, 1082
Ksp22I	TGATCA	1 cut(s)	520
Kzo9I	GATC	6 cut(s)	310, 520, 546, 670, 860, 892
LmnI	GCTCC	1 cut(s)	647
LpnPI	CCDG	8 cut(s)	99, 390, 393, 411, 438, 616, 632, 912
LweI	GCATC	6 cut(s)	202, 243, 273, 300, 796, 1059
MaeI	CTAG	1 cut(s)	623
MaeIII	GTNAC	4 cut(s)	137, 400, 454, 528
MalI	GATC	6 cut(s)	312, 522, 548, 672, 862, 894
MboI	GATC	6 cut(s)	310, 520, 546, 670, 860, 892
MboII	GAAGA	2 cut(s)	101, 886
MflI	RGATCY	1 cut(s)	860
MhlI	GDGCHC	1 cut(s)	652
MluCI	AATT	8 cut(s)	197, 331, 366, 471, 787, 826, 1060, 1144
MluI	ACGCGT	1 cut(s)	993
MmeI	TCCRAC	1 cut(s)	61
MnlI	CCTC	7 cut(s)	13, 543, 547, 861, 864, 955, 1143
MseI	TTAA	3 cut(s)	372, 677, 978
MslI	CAYNNNNRTG	1 cut(s)	1112
MvnI	CGCG	1 cut(s)	995
NcoI	CCATGG	1 cut(s)	30
NdeII	GATC	6 cut(s)	310, 520, 546, 670, 860, 892
NheI	GCTAGC	1 cut(s)	622
NlaIII	CATG	8 cut(s)	34, 181, 272, 582, 775, 815, 851, 1082
NlaIV	GGNNCC	1 cut(s)	48
NmuCI	GTSAC	2 cut(s)	137, 528
PceI	AGGCCT	1 cut(s)	23
PfeI	GAWTC	2 cut(s)	181, 513
Ple19I	CGATCG	1 cut(s)	549
PshAI	GACNNNNGTC	1 cut(s)	165
PspEI	GGTNACC	2 cut(s)	454, 528
PspN4I	GGNNCC	1 cut(s)	48
PspPI	GGNCC	3 cut(s)	34, 47, 303
PsuI	RGATCY	1 cut(s)	860
PvuI	CGATCG	1 cut(s)	549
RsaI	GTAC	3 cut(s)	558, 837, 988
RsaNI	GTAC	3 cut(s)	557, 836, 987
RseI	CAYNNNNRTG	1 cut(s)	1112
SaqAI	TTAA	3 cut(s)	372, 677, 978
Sau3AI	GATC	6 cut(s)	310, 520, 546, 670, 860, 892
Sau96I	GGNCC	3 cut(s)	34, 47, 303
SduI	GDGCHC	1 cut(s)	652
SfaNI	GCATC	6 cut(s)	202, 243, 273, 300, 796, 1059
SinI	GGWCC	2 cut(s)	34, 47
SmiMI	CAYNNNNRTG	1 cut(s)	1112
SmlI	CTYRAG	2 cut(s)	1037, 1100
SmoI	CTYRAG	2 cut(s)	1037, 1100
Sse9I	AATT	8 cut(s)	197, 331, 366, 471, 787, 826, 1060, 1144
SseBI	AGGCCT	1 cut(s)	23
SsiI	CCGC	4 cut(s)	175, 208, 439, 468
SspMI	CTAG	1 cut(s)	623
StuI	AGGCCT	1 cut(s)	23
StyI	CCWWGG	2 cut(s)	30, 41
TaaI	ACNGT	2 cut(s)	710, 953
TaqI	TCGA	1 cut(s)	1148
TasI	AATT	8 cut(s)	197, 331, 366, 471, 787, 826, 1060, 1144
TfiI	GAWTC	2 cut(s)	181, 513
Tru1I	TTAA	3 cut(s)	372, 677, 978
Tru9I	TTAA	3 cut(s)	372, 677, 978
TscAI	CASTG	2 cut(s)	715, 741
TseFI	GTSAC	2 cut(s)	137, 528
Tsp45I	GTSAC	2 cut(s)	137, 528
TspDTI	ATGAA	6 cut(s)	194, 242, 567, 684, 809, 959
TspRI	CASTG	2 cut(s)	715, 741
VpaK11BI	GGWCC	2 cut(s)	34, 47
XagI	CCTNNNNNAGG	1 cut(s)	402
XapI	RAATTY	3 cut(s)	331, 1060, 1144
XcmI	CCANNNNNNNNNTGG	1 cut(s)	470
XspI	CTAG	1 cut(s)	623

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.