Rh2BG355200

F-box associated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0004545
Physical Location & Seq
Reverse (-)
48749959 .. 48754364
4406 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG355200.1

Sequence Viewer

Length: 363 bp
ATGGTTCGTGTTCAGGGTGTTCAGGAGGGGACCAATGCTGCTCATGATAGGGGTGATACGTATTGCAGCGGTGGTTGGAAGCTGGTGATGGAAGATGATCGAGGAAGACCTGATCGGTGCAGGATTTCTTTGGCGACGACGGCGATGGCGTGTGGCAAGAACCCTTTACTCAACAACTCTGGTTTTGATTTGGAAGACCATGCTGATGACGATGGCACTTTAAAGTCTATTCCCTGGCCTGTCCGCATGAGTATTACCAATTGCAAAATTCGGTTGCGCAATCCTGGGGAGGCATTCAACTACCACAATAAGCTCATTAATTATATACTTAACAGGAAACGTGGTGCTAAAAAGGAAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBA_1

Protein Analysis

120

Amino Acids

13.48

Weight (kDa)

9.0

Isoelectric Point (pI)

24.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 278
AciI CCGC 2 cut(s) 69, 244
AcsI RAATTY 1 cut(s) 267
AgsI TTSAA 1 cut(s) 298
AjnI CCWGG 2 cut(s) 233, 283
AluBI AGCT 2 cut(s) 82, 313
AluI AGCT 2 cut(s) 82, 313
AoxI GGCC 1 cut(s) 236
ApeKI GCWGC 2 cut(s) 38, 66
ApoI RAATTY 1 cut(s) 267
AseI ATTAAT 1 cut(s) 318
AspLEI GCGC 1 cut(s) 279
AspS9I GGNCC 1 cut(s) 30
AsuHPI GGTGA 2 cut(s) 65, 97
AvaII GGWCC 1 cut(s) 30
BbsI GAAGAC 2 cut(s) 112, 201
BbvI GCAGC 2 cut(s) 25, 78
BccI CCATC 3 cut(s) 82, 139, 206
BceAI ACGGC 1 cut(s) 156
BciT130I CCWGG 2 cut(s) 235, 285
BisI GCNGC 2 cut(s) 39, 67
BlsI GCNGC 2 cut(s) 40, 68
Bme1390I CCNGG 2 cut(s) 235, 285
Bme18I GGWCC 1 cut(s) 30
BmgT120I GGNCC 1 cut(s) 30
BmiI GGNNCC 1 cut(s) 31
BmrFI CCNGG 2 cut(s) 235, 285
BpiI GAAGAC 2 cut(s) 112, 201
BsaAI YACGTR 1 cut(s) 60
BsaJI CCNNGG 2 cut(s) 233, 284
BseBI CCWGG 2 cut(s) 235, 285
BseDI CCNNGG 2 cut(s) 233, 284
BseXI GCAGC 2 cut(s) 25, 78
BsgI GTGCAG 1 cut(s) 139
BshFI GGCC 1 cut(s) 238
BslFI GGGAC 1 cut(s) 43
BsmFI GGGAC 1 cut(s) 43
BsmI GAATGC 1 cut(s) 293
BsnI GGCC 1 cut(s) 238
Bsp143I GATC 2 cut(s) 97, 112
BspACI CCGC 2 cut(s) 69, 244
BspANI GGCC 1 cut(s) 238
BspHI TCATGA 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 31
BssECI CCNNGG 2 cut(s) 233, 284
BssMI GATC 2 cut(s) 97, 112
Bst2UI CCWGG 2 cut(s) 235, 285
BstBAI YACGTR 1 cut(s) 60
BstHHI GCGC 1 cut(s) 279
BstKTI GATC 2 cut(s) 100, 115
BstMBI GATC 2 cut(s) 97, 112
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstNI CCWGG 2 cut(s) 235, 285
BstSCI CCNGG 2 cut(s) 233, 283
BstSNI TACGTA 1 cut(s) 60
BstV1I GCAGC 2 cut(s) 25, 78
BstV2I GAAGAC 2 cut(s) 112, 201
BsuRI GGCC 1 cut(s) 238
BtgZI GCGATG 1 cut(s) 158
CciI TCATGA 1 cut(s) 43
CfoI GCGC 1 cut(s) 279
Cfr13I GGNCC 1 cut(s) 30
CviAII CATG 3 cut(s) 44, 200, 247
CviJI RGCY 3 cut(s) 82, 238, 313
CviKI_1 RGCY 3 cut(s) 82, 238, 313
DpnI GATC 2 cut(s) 99, 114
DpnII GATC 2 cut(s) 97, 112
DraI TTTAAA 1 cut(s) 222
Eco105I TACGTA 1 cut(s) 60
Eco47I GGWCC 1 cut(s) 30
EcoRII CCWGG 2 cut(s) 233, 283
FaeI CATG 3 cut(s) 47, 203, 250
FaiI YATR 6 cut(s) 45, 201, 248, 324, 326, 361
FaqI GGGAC 1 cut(s) 43
FatI CATG 3 cut(s) 43, 199, 246
Fnu4HI GCNGC 2 cut(s) 39, 67
Fsp4HI GCNGC 2 cut(s) 39, 67
FspI TGCGCA 1 cut(s) 278
GlaI GCGC 1 cut(s) 278
GluI GCNGC 2 cut(s) 39, 67
HaeIII GGCC 1 cut(s) 238
HhaI GCGC 1 cut(s) 279
Hin1II CATG 3 cut(s) 47, 203, 250
Hin6I GCGC 1 cut(s) 277
HinP1I GCGC 1 cut(s) 277
HphI GGTGA 2 cut(s) 65, 97
Hpy188III TCNNGA 2 cut(s) 23, 44
Hpy99I CGWCG 2 cut(s) 139, 142
HpyCH4IV ACGT 2 cut(s) 59, 340
HpyCH4V TGCA 3 cut(s) 66, 120, 264
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HpySE526I ACGT 2 cut(s) 59, 340
Hsp92II CATG 3 cut(s) 47, 203, 250
HspAI GCGC 1 cut(s) 277
Kzo9I GATC 2 cut(s) 97, 112
Lsp1109I GCAGC 2 cut(s) 25, 78
MaeII ACGT 2 cut(s) 59, 340
MalI GATC 2 cut(s) 99, 114
MboI GATC 2 cut(s) 97, 112
MboII GAAGA 3 cut(s) 104, 117, 206
MfeI CAATTG 1 cut(s) 259
MluCI AATT 3 cut(s) 259, 267, 319
MmeI TCCRAC 1 cut(s) 56
MnlI CCTC 3 cut(s) 19, 95, 283
MseI TTAA 3 cut(s) 221, 318, 330
MslI CAYNNNNRTG 1 cut(s) 204
MspA1I CMGCKG 1 cut(s) 69
MspR9I CCNGG 2 cut(s) 235, 285
MunI CAATTG 1 cut(s) 259
Mva1269I GAATGC 1 cut(s) 293
MvaI CCWGG 2 cut(s) 235, 285
MwoI GCNNNNNNNGC 1 cut(s) 140
NdeII GATC 2 cut(s) 97, 112
NlaIII CATG 3 cut(s) 47, 203, 250
NlaIV GGNNCC 1 cut(s) 31
NsbI TGCGCA 1 cut(s) 278
PagI TCATGA 1 cut(s) 43
PcsI WCGNNNNNNNCGW 1 cut(s) 146
PctI GAATGC 1 cut(s) 293
PkrI GCNGC 2 cut(s) 40, 68
Ppu21I YACGTR 1 cut(s) 60
PshBI ATTAAT 1 cut(s) 318
Psp6I CCWGG 2 cut(s) 233, 283
PspGI CCWGG 2 cut(s) 233, 283
PspN4I GGNNCC 1 cut(s) 31
PspPI GGNCC 1 cut(s) 30
RseI CAYNNNNRTG 1 cut(s) 204
SaqAI TTAA 3 cut(s) 221, 318, 330
SatI GCNGC 2 cut(s) 39, 67
Sau3AI GATC 2 cut(s) 97, 112
Sau96I GGNCC 1 cut(s) 30
ScrFI CCNGG 2 cut(s) 235, 285
SetI ASST 5 cut(s) 62, 84, 112, 315, 343
SinI GGWCC 1 cut(s) 30
SmiMI CAYNNNNRTG 1 cut(s) 204
SnaBI TACGTA 1 cut(s) 60
Sse9I AATT 3 cut(s) 259, 267, 319
SsiI CCGC 2 cut(s) 69, 244
StyD4I CCNGG 2 cut(s) 233, 283
TaiI ACGT 2 cut(s) 62, 343
TaqI TCGA 1 cut(s) 100
TasI AATT 3 cut(s) 259, 267, 319
Tru1I TTAA 3 cut(s) 221, 318, 330
Tru9I TTAA 3 cut(s) 221, 318, 330
TseI GCWGC 2 cut(s) 38, 66
VpaK11BI GGWCC 1 cut(s) 30
VspI ATTAAT 1 cut(s) 318
XapI RAATTY 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.