Rh2CG334000

F-box associated

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
43949952 .. 43950446
495 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG334000.1

Sequence Viewer

Length: 495 bp
ATGACAGGAGTGATCTATTGGTTTTACCTTGAGCTTTCTTCGTCTTGCATAGATTCTTTTGACATTGACAATGGAAGGTTCCAGTCAGTTCCACCACTTCCTTTTGAACTGAGAACAAGTAATCATCATGTTAGTTTGGGAGTTTTAGGTGATTTTCTTTCTGTGTGTGAAGTTGCTTTCCTTGATGACATTAATGTGTGGGTAATGATAGATAATGGTGGAGAGAAGTCTTGGATGAAAGAACTATGTATTTGTACTTTTAGTCATGAAAGGCAGTGGCCGTTTGGCTTATATCAACCGATGAAATACTCTCACAATGGAGGTTTGGTGATCTTTCATTCTAGTAGTAATGCCTTCATGTACTATCACCCAAAAGACCAAACATACAAATACCTTAAGCTTTGCGGATCTCAATCAAATTGTGAAGCCGTTAGTCATGTTCCAACCTTCATTTCGCTCAAGAGCATTTTAACTGGGGCCAAAACAGAAGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

164

Amino Acids

18.67

Weight (kDa)

5.73

Isoelectric Point (pI)

41.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FBA_1 PF07734 2 - 150 3.9e-07 F-box associated beta propeller domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 405
AclWI GGATC 1 cut(s) 415
AcoI YGGCCR 1 cut(s) 278
AfaI GTAC 2 cut(s) 256, 362
AflII CTTAAG 1 cut(s) 395
AgsI TTSAA 1 cut(s) 107
AjuI GAANNNNNNNTTGG 2 cut(s) 436, 468
AluBI AGCT 2 cut(s) 34, 400
AluI AGCT 2 cut(s) 34, 400
AlwI GGATC 1 cut(s) 415
AoxI GGCC 2 cut(s) 278, 477
AseI ATTAAT 1 cut(s) 192
AspS9I GGNCC 1 cut(s) 477
AsuHPI GGTGA 3 cut(s) 161, 340, 359
BceAI ACGGC 2 cut(s) 265, 413
BfaI CTAG 1 cut(s) 342
BfrI CTTAAG 1 cut(s) 395
BmgT120I GGNCC 1 cut(s) 477
BmiI GGNNCC 2 cut(s) 80, 478
BmrI ACTGGG 1 cut(s) 483
BmuI ACTGGG 1 cut(s) 483
BpuEI CTTGAG 2 cut(s) 50, 443
BsaBI GATNNNNATC 1 cut(s) 412
BsaXI ACNNNNNCTCC 2 cut(s) 312, 342
Bse1I ACTGG 2 cut(s) 82, 478
Bse8I GATNNNNATC 1 cut(s) 412
BseGI GGATG 1 cut(s) 240
BseJI GATNNNNATC 1 cut(s) 412
BseMII CTCAG 1 cut(s) 101
BseNI ACTGG 2 cut(s) 82, 478
BshFI GGCC 2 cut(s) 280, 479
BsnI GGCC 2 cut(s) 280, 479
Bsp143I GATC 3 cut(s) 12, 330, 407
BspACI CCGC 1 cut(s) 405
BspANI GGCC 2 cut(s) 280, 479
BspCNI CTCAG 1 cut(s) 102
BspHI TCATGA 1 cut(s) 265
BspLI GGNNCC 2 cut(s) 80, 478
BspPI GGATC 1 cut(s) 415
BspTI CTTAAG 1 cut(s) 395
BsrI ACTGG 2 cut(s) 82, 478
BssMI GATC 3 cut(s) 12, 330, 407
BstAFI CTTAAG 1 cut(s) 395
BstDEI CTNAG 1 cut(s) 110
BstF5I GGATG 1 cut(s) 240
BstKTI GATC 3 cut(s) 15, 333, 410
BstMBI GATC 3 cut(s) 12, 330, 407
BstX2I RGATCY 1 cut(s) 407
BstYI RGATCY 1 cut(s) 407
BsuRI GGCC 2 cut(s) 280, 479
BtsCI GGATG 1 cut(s) 240
BtsI GCAGTG 1 cut(s) 281
BtsIMutI CAGTG 1 cut(s) 281
CciI TCATGA 1 cut(s) 265
Cfr13I GGNCC 1 cut(s) 477
Csp6I GTAC 2 cut(s) 255, 361
CviAII CATG 4 cut(s) 128, 266, 358, 437
CviJI RGCY 6 cut(s) 34, 280, 288, 400, 428, 479
CviKI_1 RGCY 6 cut(s) 34, 280, 288, 400, 428, 479
CviQI GTAC 2 cut(s) 255, 361
DdeI CTNAG 1 cut(s) 110
DpnI GATC 3 cut(s) 14, 332, 409
DpnII GATC 3 cut(s) 12, 330, 407
EaeI YGGCCR 1 cut(s) 278
FaeI CATG 4 cut(s) 131, 269, 361, 440
FaiI YATR 9 cut(s) 50, 129, 247, 267, 292, 359, 385, 438, 493
FatI CATG 4 cut(s) 127, 265, 357, 436
FokI GGATG 1 cut(s) 247
FspBI CTAG 1 cut(s) 342
HaeIII GGCC 2 cut(s) 280, 479
Hin1II CATG 4 cut(s) 131, 269, 361, 440
HindIII AAGCTT 1 cut(s) 398
HinfI GANTC 1 cut(s) 53
HphI GGTGA 3 cut(s) 161, 340, 359
Hpy188III TCNNGA 2 cut(s) 266, 460
HpyAV CCTTC 3 cut(s) 69, 364, 457
HpyCH4V TGCA 1 cut(s) 48
HpyF3I CTNAG 1 cut(s) 110
Hsp92II CATG 4 cut(s) 131, 269, 361, 440
Kzo9I GATC 3 cut(s) 12, 330, 407
LpnPI CCDG 2 cut(s) 95, 459
MaeI CTAG 1 cut(s) 342
MalI GATC 3 cut(s) 14, 332, 409
MboI GATC 3 cut(s) 12, 330, 407
MboII GAAGA 1 cut(s) 30
MflI RGATCY 1 cut(s) 407
MluCI AATT 1 cut(s) 418
MmeI TCCRAC 1 cut(s) 467
MnlI CCTC 1 cut(s) 314
MseI TTAA 3 cut(s) 192, 396, 470
MslI CAYNNNNRTG 1 cut(s) 194
MspCI CTTAAG 1 cut(s) 395
NdeII GATC 3 cut(s) 12, 330, 407
NlaIII CATG 4 cut(s) 131, 269, 361, 440
NlaIV GGNNCC 2 cut(s) 80, 478
PagI TCATGA 1 cut(s) 265
PfeI GAWTC 1 cut(s) 53
PshBI ATTAAT 1 cut(s) 192
PspN4I GGNNCC 2 cut(s) 80, 478
PspPI GGNCC 1 cut(s) 477
PsuI RGATCY 1 cut(s) 407
RsaI GTAC 2 cut(s) 256, 362
RsaNI GTAC 2 cut(s) 255, 361
RseI CAYNNNNRTG 1 cut(s) 194
SaqAI TTAA 3 cut(s) 192, 396, 470
Sau3AI GATC 3 cut(s) 12, 330, 407
Sau96I GGNCC 1 cut(s) 477
SetI ASST 8 cut(s) 30, 36, 80, 151, 325, 396, 402, 449
SmiMI CAYNNNNRTG 1 cut(s) 194
SmlI CTYRAG 3 cut(s) 29, 395, 458
SmoI CTYRAG 3 cut(s) 29, 395, 458
Sse9I AATT 1 cut(s) 418
SsiI CCGC 1 cut(s) 405
SspMI CTAG 1 cut(s) 342
TasI AATT 1 cut(s) 418
TatI WGTACW 2 cut(s) 254, 360
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 3 cut(s) 192, 396, 470
Tru9I TTAA 3 cut(s) 192, 396, 470
TscAI CASTG 1 cut(s) 281
TspDTI ATGAA 6 cut(s) 251, 282, 317, 326, 346, 439
TspRI CASTG 1 cut(s) 281
Vha464I CTTAAG 1 cut(s) 395
VspI ATTAAT 1 cut(s) 192
XspI CTAG 1 cut(s) 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.