Rmu_sc0004577.1_g000006
MYB Family

Alcohol dehydrogenase transcription factor Myb/SANT-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004577.1
OG0001994
Physical Location & Seq
Forward (+)
12654 .. 13388
735 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004577.1_g000006.1.cds

Sequence Viewer

Length: 456 bp
atgaccaattctggaaattcgccgagtcattggccttggttcatgataatggagcagatcgtcggcaattttcttccggcgaaggctacctctgatgatgacagaggcattacttcctccgttggtcactctctgtttgtttttggcagaaatgcaagtgcaattactagtcctgtaactcagataaataagcagtcgaaaattagtcttaaatggcgaagagtggtgttcaaagtcagtggtgctgctctagctgccactgctgctaacaacattgacccaaagataacaatgctgattgcgagagaagttgcaatggcctacctctgtggggtggaggtaatgatgttgcaattgttgttggcggtcgtaactttggctgatgggtgtggcggatttgggggtttgggcggtcggagcggagggtcatggagattgcgatggcggcgagtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AA_kinase Myb_DNA-bind_4

Protein Analysis

151

Amino Acids

16.27

Weight (kDa)

10.36

Isoelectric Point (pI)

41.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 420
AciI CCGC 5 cut(s) 365, 393, 411, 420, 445
AcsI RAATTY 1 cut(s) 16
AfiI CCNNNNNNNGG 1 cut(s) 331
AgsI TTSAA 1 cut(s) 232
AhlI ACTAGT 1 cut(s) 167
AluBI AGCT 1 cut(s) 254
AluI AGCT 1 cut(s) 254
AoxI GGCC 2 cut(s) 32, 318
ApeKI GCWGC 3 cut(s) 245, 254, 263
ApoI RAATTY 1 cut(s) 16
BbvI GCAGC 3 cut(s) 232, 241, 250
BccI CCATC 2 cut(s) 377, 435
BcuI ACTAGT 1 cut(s) 167
BfaI CTAG 2 cut(s) 168, 251
BisI GCNGC 4 cut(s) 246, 255, 264, 446
BlsI GCNGC 4 cut(s) 247, 256, 265, 447
BsaJI CCNNGG 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 331
Bse3DI GCAATG 1 cut(s) 321
BseDI CCNNGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 331
BseMI GCAATG 1 cut(s) 321
BseMII CTCAG 1 cut(s) 194
BseXI GCAGC 3 cut(s) 232, 241, 250
Bsh1285I CGRYCG 2 cut(s) 369, 415
BshFI GGCC 2 cut(s) 34, 320
BsiEI CGRYCG 2 cut(s) 369, 415
BsiSI CCGG 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 331
BsnI GGCC 2 cut(s) 34, 320
Bsp143I GATC 1 cut(s) 57
BspACI CCGC 5 cut(s) 365, 393, 411, 420, 445
BspANI GGCC 2 cut(s) 34, 320
BspCNI CTCAG 1 cut(s) 193
BspHI TCATGA 1 cut(s) 42
BsrBI CCGCTC 1 cut(s) 420
BsrDI GCAATG 1 cut(s) 321
BssECI CCNNGG 1 cut(s) 35
BssMI GATC 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 35
Bst6I CTCTTC 1 cut(s) 214
BstDEI CTNAG 1 cut(s) 180
BstKTI GATC 1 cut(s) 60
BstMBI GATC 1 cut(s) 57
BstMCI CGRYCG 2 cut(s) 369, 415
BstMWI GCNNNNNNNGC 6 cut(s) 251, 254, 260, 263, 417, 445
BstV1I GCAGC 3 cut(s) 232, 241, 250
BsuRI GGCC 2 cut(s) 34, 320
BtsI GCAGTG 1 cut(s) 258
BtsIMutI CAGTG 2 cut(s) 244, 258
CciI TCATGA 1 cut(s) 42
CspCI CAANNNNNGTGG 2 cut(s) 220, 255
CviAII CATG 2 cut(s) 43, 429
CviJI RGCY 5 cut(s) 34, 86, 254, 320, 380
CviKI_1 RGCY 5 cut(s) 34, 86, 254, 320, 380
DdeI CTNAG 1 cut(s) 180
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
Eam1104I CTCTTC 1 cut(s) 214
EarI CTCTTC 1 cut(s) 214
EciI GGCGGA 1 cut(s) 408
Eco130I CCWWGG 1 cut(s) 35
EcoT14I CCWWGG 1 cut(s) 35
ErhI CCWWGG 1 cut(s) 35
FaeI CATG 2 cut(s) 46, 432
FaiI YATR 3 cut(s) 44, 430, 454
FatI CATG 2 cut(s) 42, 428
Fnu4HI GCNGC 4 cut(s) 246, 255, 264, 446
Fsp4HI GCNGC 4 cut(s) 246, 255, 264, 446
FspBI CTAG 2 cut(s) 168, 251
GluI GCNGC 4 cut(s) 246, 255, 264, 446
HaeIII GGCC 2 cut(s) 34, 320
HapII CCGG 1 cut(s) 77
Hin1II CATG 2 cut(s) 46, 432
HinfI GANTC 1 cut(s) 25
HpaII CCGG 1 cut(s) 77
Hpy188I TCNGA 3 cut(s) 94, 183, 417
Hpy188III TCNNGA 2 cut(s) 12, 43
Hpy99I CGWCG 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 76
HpyCH4V TGCA 4 cut(s) 155, 161, 314, 352
HpyF10VI GCNNNNNNNGC 6 cut(s) 251, 254, 260, 263, 417, 445
HpyF3I CTNAG 1 cut(s) 180
Hsp92II CATG 2 cut(s) 46, 432
Kzo9I GATC 1 cut(s) 57
LmnI GCTCC 2 cut(s) 52, 417
LpnPI CCDG 2 cut(s) 90, 186
Lsp1109I GCAGC 3 cut(s) 232, 241, 250
MaeI CTAG 2 cut(s) 168, 251
MaeIII GTNAC 3 cut(s) 125, 175, 370
MalI GATC 1 cut(s) 59
MbiI CCGCTC 1 cut(s) 420
MboI GATC 1 cut(s) 57
MboII GAAGA 2 cut(s) 65, 231
MfeI CAATTG 1 cut(s) 353
MluCI AATT 6 cut(s) 7, 16, 67, 162, 201, 353
MlyI GAGTC 1 cut(s) 34
MmeI TCCRAC 1 cut(s) 395
MnlI CCTC 6 cut(s) 98, 100, 127, 331, 335, 416
MseI TTAA 1 cut(s) 210
MslI CAYNNNNRTG 1 cut(s) 47
MspI CCGG 1 cut(s) 77
MunI CAATTG 1 cut(s) 353
MwoI GCNNNNNNNGC 6 cut(s) 251, 254, 260, 263, 417, 445
NdeII GATC 1 cut(s) 57
NlaIII CATG 2 cut(s) 46, 432
NmeAIII GCCGAG 1 cut(s) 48
NmuCI GTSAC 1 cut(s) 125
PagI TCATGA 1 cut(s) 42
PkrI GCNGC 4 cut(s) 247, 256, 265, 447
PleI GAGTC 1 cut(s) 33
PpsI GAGTC 1 cut(s) 33
RseI CAYNNNNRTG 1 cut(s) 47
SaqAI TTAA 1 cut(s) 210
SatI GCNGC 4 cut(s) 246, 255, 264, 446
Sau3AI GATC 1 cut(s) 57
SchI GAGTC 1 cut(s) 34
SetI ASST 4 cut(s) 92, 256, 327, 342
SmiMI CAYNNNNRTG 1 cut(s) 47
SpeI ACTAGT 1 cut(s) 167
Sse9I AATT 6 cut(s) 7, 16, 67, 162, 201, 353
SsiI CCGC 5 cut(s) 365, 393, 411, 420, 445
SspMI CTAG 2 cut(s) 168, 251
StyI CCWWGG 1 cut(s) 35
TaqI TCGA 1 cut(s) 197
TasI AATT 6 cut(s) 7, 16, 67, 162, 201, 353
TauI GCSGC 1 cut(s) 448
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
TscAI CASTG 2 cut(s) 244, 265
TseFI GTSAC 1 cut(s) 125
TseI GCWGC 3 cut(s) 245, 254, 263
Tsp45I GTSAC 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 31
TspGWI ACGGA 1 cut(s) 109
TspRI CASTG 2 cut(s) 244, 265
XapI RAATTY 1 cut(s) 16
XspI CTAG 2 cut(s) 168, 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.