Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006493.1

Orthogroup ID

OG0004878

Physical Location & Seq

Genomic Coordinates Reverse (-)

71617 .. 76241

Gene Structure 4625 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 711 bp

atgtcgttttgcatcgatctttatccagccggagctgagtcgccggtggaaactggacctccatctccgattggaaagctacctagagacgaaatggaaggcaacgataatcatgaagacggtcggagttgcggccgagattcggtgctcgagactcgatctgtgcctacagcttcttcttcctcatcgcagattttgttctcatttcccgctcccaaaaccctaacccgaacatcgcgtcggctttctagtgtcgagtggaggccaaagattacatcaagatcaaggatatggcattcaaggcctcgggagcctacaaaaactgcaagccgtgctcgaggcggtgtggtgaccactggaaccggaactgttcggactctgatatgtcggcaaagttttgagatcctggtatttccttgcaaccagtttgcaggacaagagccaggaaacaataaggagattcaggaagttgcatgtatgaggttgaaagttgaatttctgatctttgacaagagagagagagagagaaaccataggagacttcgccggagcccatcaccggccgtcggaatccggtcaccggctgccgaaattccggccaactttcacaggaatccagtcactggtcgctggaatccggtgactagtcaccggtcgccggaatccggtgaccagtcgctggatttcgacagaactttttctcgttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0005886 GO:0016020 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00480 ko00590 ko04918 map00480 map00590 map04918

Pfam Domains

Protein Families

GSHPx

Protein Analysis

236

Amino Acids

26.45

Weight (kDa)

10.19

Isoelectric Point (pI)

87.36

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
GSHPx	PF00255	131 - 173	5.6e-10	Glutathione peroxidase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004878)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0099351 RchiOBHm_Chr2g0103041 RchiOBHm_Chr2g0150881 RchiOBHm_Chr3g0495181 RchiOBHm_Chr4g0387961 RchiOBHm_Chr5g0055791 RchiOBHm_Chr7g0184561
rosa_laevigata	RLG00000001087 RLG00000012261 RLG00000014393 RLG00000030000
rosa_multiflora	Rmu_sc0006188.1_g000006 Rmu_sc0006493.1_g000021 Rmu_sc0032246.1_g000001 Rmu_sc0038175.1_g000001
rosa_roxburghii	Rroxscaffold_1G00034240 Rroxscaffold_4G00294030 Rroxscaffold_4G00295050 Rroxscaffold_6G00393460 Rroxscaffold_6G00417660 Rroxscaffold_6G00425110
rosa_rugosa	Rorug07G0313500
rosa_samantha	Rh1BG011700 Rh2AG245400 Rh3AG184600 Rh4CG286600 Rh5BG376400 Rh5CG399400 Rh7CG049100 Rh7CG068800 Rh7DG068200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	623, 679
AccBSI	CCGCTC	1 cut(s)	212
AccII	CGCG	1 cut(s)	238
AciI	CCGC	3 cut(s)	132, 210, 342
AclWI	GGATC	1 cut(s)	397
AcoI	YGGCCR	3 cut(s)	133, 561, 597
AcsI	RAATTY	2 cut(s)	494, 591
AfiI	CCNNNNNNNGG	8 cut(s)	142, 559, 566, 580, 623, 658, 665, 679
AgeI	ACCGGT	1 cut(s)	651
AgsI	TTSAA	3 cut(s)	300, 487, 494
AhlI	ACTAGT	1 cut(s)	644
AjnI	CCWGG	2 cut(s)	405, 442
AluBI	AGCT	3 cut(s)	35, 79, 173
AluI	AGCT	3 cut(s)	35, 79, 173
Alw21I	GWGCWC	2 cut(s)	150, 337
Alw26I	GTCTC	3 cut(s)	81, 146, 532
AlwI	GGATC	1 cut(s)	397
AlwNI	CAGNNNCTG	2 cut(s)	623, 679
Ama87I	CYCGRG	3 cut(s)	149, 306, 336
AoxI	GGCC	5 cut(s)	133, 263, 302, 561, 597
ApeKI	GCWGC	1 cut(s)	584
ApoI	RAATTY	2 cut(s)	494, 591
ArsI	GACNNNNNNTTYG	2 cut(s)	223, 255
AsiGI	ACCGGT	1 cut(s)	651
Asp700I	GAANNNNTTC	1 cut(s)	697
AspS9I	GGNCC	1 cut(s)	56
AsuHPI	GGTGA	6 cut(s)	361, 549, 570, 641, 652, 680
AvaI	CYCGRG	3 cut(s)	149, 306, 336
AvaII	GGWCC	1 cut(s)	56
BanII	GRGCYC	1 cut(s)	554
BbsI	GAAGAC	1 cut(s)	123
Bbv12I	GWGCWC	2 cut(s)	150, 337
BbvI	GCAGC	1 cut(s)	571
BccI	CCATC	2 cut(s)	70, 562
BceAI	ACGGC	2 cut(s)	315, 548
BciT130I	CCWGG	2 cut(s)	407, 444
BcoDI	GTCTC	3 cut(s)	81, 146, 532
BcuI	ACTAGT	1 cut(s)	644
BfaI	CTAG	3 cut(s)	84, 249, 645
BfmI	CTRYAG	1 cut(s)	168
BisI	GCNGC	2 cut(s)	133, 585
BlsI	GCNGC	2 cut(s)	134, 586
Bme1390I	CCNGG	2 cut(s)	407, 444
Bme18I	GGWCC	1 cut(s)	56
BmeT110I	CYCGRG	3 cut(s)	149, 306, 336
BmgT120I	GGNCC	1 cut(s)	56
BmiI	GGNNCC	3 cut(s)	312, 361, 551
BmrFI	CCNGG	2 cut(s)	407, 444
BmsI	GCATC	1 cut(s)	21
BpiI	GAAGAC	1 cut(s)	123
Bsa29I	ATCGAT	1 cut(s)	15
BsaBI	GATNNNNATC	1 cut(s)	21
BsaJI	CCNNGG	1 cut(s)	305
BsaWI	WCCGGW	5 cut(s)	362, 573, 637, 651, 665
BsaXI	ACNNNNNCTCC	2 cut(s)	43, 73
Bsc4I	CCNNNNNNNGG	8 cut(s)	142, 559, 566, 580, 623, 658, 665, 679
Bse118I	RCCGGY	4 cut(s)	43, 559, 580, 651
Bse1I	ACTGG	6 cut(s)	58, 361, 424, 617, 628, 673
Bse8I	GATNNNNATC	1 cut(s)	21
BseBI	CCWGG	2 cut(s)	407, 444
BseCI	ATCGAT	1 cut(s)	15
BseDI	CCNNGG	1 cut(s)	305
BseJI	GATNNNNATC	1 cut(s)	21
BseLI	CCNNNNNNNGG	8 cut(s)	142, 559, 566, 580, 623, 658, 665, 679
BseMII	CTCAG	1 cut(s)	27
BseNI	ACTGG	6 cut(s)	58, 361, 424, 617, 628, 673
BseX3I	CGGCCG	2 cut(s)	133, 561
BseXI	GCAGC	1 cut(s)	571
Bsh1236I	CGCG	1 cut(s)	238
Bsh1285I	CGRYCG	4 cut(s)	124, 136, 564, 656
BshFI	GGCC	5 cut(s)	135, 265, 304, 563, 599
BshTI	ACCGGT	1 cut(s)	651
BshVI	ATCGAT	1 cut(s)	15
BsiEI	CGRYCG	4 cut(s)	124, 136, 564, 656
BsiHKAI	GWGCWC	2 cut(s)	150, 337
BsiHKCI	CYCGRG	3 cut(s)	149, 306, 336
BslI	CCNNNNNNNGG	8 cut(s)	142, 559, 566, 580, 623, 658, 665, 679
BsmAI	GTCTC	3 cut(s)	81, 146, 532
BsmBI	CGTCTC	1 cut(s)	81
BsmI	GAATGC	1 cut(s)	295
BsnI	GGCC	5 cut(s)	135, 265, 304, 563, 599
BsoBI	CYCGRG	3 cut(s)	149, 306, 336
Bsp1286I	GDGCHC	3 cut(s)	150, 337, 554
Bsp143I	GATC	5 cut(s)	16, 158, 281, 402, 501
BspACI	CCGC	3 cut(s)	132, 210, 342
BspANI	GGCC	5 cut(s)	135, 265, 304, 563, 599
BspCNI	CTCAG	1 cut(s)	28
BspDI	ATCGAT	1 cut(s)	15
BspFNI	CGCG	1 cut(s)	238
BspHI	TCATGA	1 cut(s)	112
BspLI	GGNNCC	3 cut(s)	312, 361, 551
BspPI	GGATC	1 cut(s)	397
BsrBI	CCGCTC	1 cut(s)	212
BsrFI	RCCGGY	4 cut(s)	43, 559, 580, 651
BsrI	ACTGG	6 cut(s)	58, 361, 424, 617, 628, 673
BssAI	RCCGGY	4 cut(s)	43, 559, 580, 651
BssECI	CCNNGG	1 cut(s)	305
BssMI	GATC	5 cut(s)	16, 158, 281, 402, 501
Bst2UI	CCWGG	2 cut(s)	407, 444
Bst4CI	ACNGT	2 cut(s)	122, 370
BstAPI	GCANNNNNTGC	1 cut(s)	332
BstC8I	GCNNGC	1 cut(s)	328
BstDEI	CTNAG	1 cut(s)	36
BstEII	GGTNACC	3 cut(s)	349, 576, 668
BstFNI	CGCG	1 cut(s)	238
BstKTI	GATC	5 cut(s)	19, 161, 284, 405, 504
BstMAI	GTCTC	3 cut(s)	81, 146, 532
BstMBI	GATC	5 cut(s)	16, 158, 281, 402, 501
BstMCI	CGRYCG	4 cut(s)	124, 136, 564, 656
BstMWI	GCNNNNNNNGC	3 cut(s)	301, 310, 332
BstNI	CCWGG	2 cut(s)	407, 444
BstNSI	RCATGY	1 cut(s)	477
BstPI	GGTNACC	3 cut(s)	349, 576, 668
BstSCI	CCNGG	2 cut(s)	405, 442
BstSFI	CTRYAG	1 cut(s)	168
BstUI	CGCG	1 cut(s)	238
BstV1I	GCAGC	1 cut(s)	571
BstV2I	GAAGAC	1 cut(s)	123
BstX2I	RGATCY	1 cut(s)	402
BstYI	RGATCY	1 cut(s)	402
BstZI	CGGCCG	2 cut(s)	133, 561
Bsu15I	ATCGAT	1 cut(s)	15
BsuRI	GGCC	5 cut(s)	135, 265, 304, 563, 599
BsuTUI	ATCGAT	1 cut(s)	15
BtgZI	GCGATG	2 cut(s)	171, 219
BtsIMutI	CAGTG	2 cut(s)	354, 621
Cac8I	GCNNGC	1 cut(s)	328
CaiI	CAGNNNCTG	2 cut(s)	623, 679
CciI	TCATGA	1 cut(s)	112
Cfr10I	RCCGGY	4 cut(s)	43, 559, 580, 651
Cfr13I	GGNCC	1 cut(s)	56
ClaI	ATCGAT	1 cut(s)	15
CseI	GACGC	1 cut(s)	227
CspAI	ACCGGT	1 cut(s)	651
CviAII	CATG	2 cut(s)	113, 474
DdeI	CTNAG	1 cut(s)	36
DpnI	GATC	5 cut(s)	18, 160, 283, 404, 503
DpnII	GATC	5 cut(s)	16, 158, 281, 402, 501
EaeI	YGGCCR	3 cut(s)	133, 561, 597
EagI	CGGCCG	2 cut(s)	133, 561
EclXI	CGGCCG	2 cut(s)	133, 561
Eco147I	AGGCCT	1 cut(s)	304
Eco24I	GRGCYC	1 cut(s)	554
Eco47I	GGWCC	1 cut(s)	56
Eco52I	CGGCCG	2 cut(s)	133, 561
Eco88I	CYCGRG	3 cut(s)	149, 306, 336
Eco91I	GGTNACC	3 cut(s)	349, 576, 668
EcoO65I	GGTNACC	3 cut(s)	349, 576, 668
EcoRII	CCWGG	2 cut(s)	405, 442
EcoT38I	GRGCYC	1 cut(s)	554
Esp3I	CGTCTC	1 cut(s)	81
FaeI	CATG	2 cut(s)	116, 477
FaiI	YATR	6 cut(s)	114, 292, 385, 475, 479, 534
FatI	CATG	2 cut(s)	112, 473
FauI	CCCGC	1 cut(s)	217
Fnu4HI	GCNGC	2 cut(s)	133, 585
FriOI	GRGCYC	1 cut(s)	554
Fsp4HI	GCNGC	2 cut(s)	133, 585
FspBI	CTAG	3 cut(s)	84, 249, 645
GluI	GCNGC	2 cut(s)	133, 585
HaeIII	GGCC	5 cut(s)	135, 265, 304, 563, 599
HgaI	GACGC	1 cut(s)	227
Hin1II	CATG	2 cut(s)	116, 477
HinfI	GANTC	9 cut(s)	38, 140, 154, 376, 460, 570, 613, 634, 662
HphI	GGTGA	6 cut(s)	361, 549, 570, 641, 652, 680
Hpy188I	TCNGA	6 cut(s)	69, 126, 375, 381, 501, 569
Hpy188III	TCNNGA	6 cut(s)	113, 151, 279, 308, 464, 708
Hpy99I	CGWCG	2 cut(s)	243, 569
HpyAV	CCTTC	1 cut(s)	92
HpyCH4III	ACNGT	2 cut(s)	122, 370
HpyCH4V	TGCA	5 cut(s)	12, 326, 420, 431, 473
HpyF10VI	GCNNNNNNNGC	3 cut(s)	301, 310, 332
HpyF3I	CTNAG	1 cut(s)	36
Hsp92II	CATG	2 cut(s)	116, 477
Kzo9I	GATC	5 cut(s)	16, 158, 281, 402, 501
LmnI	GCTCC	4 cut(s)	32, 217, 310, 549
Lsp1109I	GCAGC	1 cut(s)	571
LweI	GCATC	1 cut(s)	21
MaeI	CTAG	3 cut(s)	84, 249, 645
MaeIII	GTNAC	6 cut(s)	349, 576, 619, 640, 647, 668
MalI	GATC	5 cut(s)	18, 160, 283, 404, 503
MbiI	CCGCTC	1 cut(s)	212
MboI	GATC	5 cut(s)	16, 158, 281, 402, 501
MboII	GAAGA	3 cut(s)	128, 168, 171
MflI	RGATCY	1 cut(s)	402
MhlI	GDGCHC	3 cut(s)	150, 337, 554
MluCI	AATT	2 cut(s)	494, 591
MlyI	GAGTC	3 cut(s)	47, 148, 370
MmeI	TCCRAC	2 cut(s)	104, 547
MnlI	CCTC	6 cut(s)	69, 193, 255, 315, 332, 474
MroXI	GAANNNNTTC	1 cut(s)	697
MspR9I	CCNGG	2 cut(s)	407, 444
Mva1269I	GAATGC	1 cut(s)	295
MvaI	CCWGG	2 cut(s)	407, 444
MvnI	CGCG	1 cut(s)	238
MwoI	GCNNNNNNNGC	3 cut(s)	301, 310, 332
NdeII	GATC	5 cut(s)	16, 158, 281, 402, 501
NlaIII	CATG	2 cut(s)	116, 477
NlaIV	GGNNCC	3 cut(s)	312, 361, 551
NmeAIII	GCCGAG	1 cut(s)	161
NmuCI	GTSAC	6 cut(s)	349, 576, 619, 640, 647, 668
NspI	RCATGY	1 cut(s)	477
PaeR7I	CTCGAG	2 cut(s)	149, 336
PagI	TCATGA	1 cut(s)	112
PceI	AGGCCT	1 cut(s)	304
PctI	GAATGC	1 cut(s)	295
PdmI	GAANNNNTTC	1 cut(s)	697
PfeI	GAWTC	6 cut(s)	140, 460, 570, 613, 634, 662
PflMI	CCANNNNNTGG	2 cut(s)	623, 679
PinAI	ACCGGT	1 cut(s)	651
PkrI	GCNGC	2 cut(s)	134, 586
PleI	GAGTC	3 cut(s)	46, 148, 370
PpsI	GAGTC	3 cut(s)	46, 148, 370
Psp6I	CCWGG	2 cut(s)	405, 442
PspEI	GGTNACC	3 cut(s)	349, 576, 668
PspGI	CCWGG	2 cut(s)	405, 442
PspN4I	GGNNCC	3 cut(s)	312, 361, 551
PspPI	GGNCC	1 cut(s)	56
PspXI	VCTCGAGB	1 cut(s)	336
PstNI	CAGNNNCTG	2 cut(s)	623, 679
PsuI	RGATCY	1 cut(s)	402
SatI	GCNGC	2 cut(s)	133, 585
Sau3AI	GATC	5 cut(s)	16, 158, 281, 402, 501
Sau96I	GGNCC	1 cut(s)	56
SchI	GAGTC	3 cut(s)	47, 148, 370
ScrFI	CCNGG	2 cut(s)	407, 444
SduI	GDGCHC	3 cut(s)	150, 337, 554
SetI	ASST	6 cut(s)	37, 61, 81, 85, 175, 485
SfaNI	GCATC	1 cut(s)	21
SfcI	CTRYAG	1 cut(s)	168
Sfr274I	CTCGAG	2 cut(s)	149, 336
SgrAI	CRCCGGYG	1 cut(s)	43
SinI	GGWCC	1 cut(s)	56
SlaI	CTCGAG	2 cut(s)	149, 336
SmlI	CTYRAG	2 cut(s)	149, 336
SmoI	CTYRAG	2 cut(s)	149, 336
SpeI	ACTAGT	1 cut(s)	644
Sse9I	AATT	2 cut(s)	494, 591
SseBI	AGGCCT	1 cut(s)	304
SsiI	CCGC	3 cut(s)	132, 210, 342
SspMI	CTAG	3 cut(s)	84, 249, 645
StuI	AGGCCT	1 cut(s)	304
StyD4I	CCNGG	2 cut(s)	405, 442
TaaI	ACNGT	2 cut(s)	122, 370
TaqI	TCGA	6 cut(s)	15, 150, 157, 255, 337, 687
TasI	AATT	2 cut(s)	494, 591
TauI	GCSGC	1 cut(s)	135
TfiI	GAWTC	6 cut(s)	140, 460, 570, 613, 634, 662
TscAI	CASTG	2 cut(s)	361, 628
TseFI	GTSAC	6 cut(s)	349, 576, 619, 640, 647, 668
TseI	GCWGC	1 cut(s)	584
Tsp45I	GTSAC	6 cut(s)	349, 576, 619, 640, 647, 668
TspDTI	ATGAA	1 cut(s)	129
TspRI	CASTG	2 cut(s)	361, 628
Van91I	CCANNNNNTGG	2 cut(s)	623, 679
VpaK11BI	GGWCC	1 cut(s)	56
XapI	RAATTY	2 cut(s)	494, 591
XceI	RCATGY	1 cut(s)	477
XhoI	CTCGAG	2 cut(s)	149, 336
XmnI	GAANNNNTTC	1 cut(s)	697
XspI	CTAG	3 cut(s)	84, 249, 645

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.