Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010062.1

Orthogroup ID

OG0001997

Physical Location & Seq

Genomic Coordinates Reverse (-)

18729 .. 23822

Gene Structure 5094 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010062.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 975 bp

atgactatgttgtttcgggaagggagatttaaaatgggatcgtggatatcactcctttcaattagtaggctcaggttgttgttcactccggcaatgaaacgatttttgggttccaattttctgtacaccatgaatcgaggtgcattgctcgccttagattggggttacgtggtgggcttagggactttggatctactacttgaccttgggctggagatcagatctttcttgagcctgcctctccatatccctcaaaatctccttgccctaatcttaagggtttatccggaggggacacaccttatcatcccatggtttgagaggccggttatttatgatgttcgtgcccgacctcatctggtggagagcacttctggcagccgtgatctccaaatggtgaaaatcgggcttagagttcttactcgtccaatatcagaccagctgcctacagtatatcgaactcttggtgagaattataatgagagagtccttccttccatcgttcatgaaactttgaaggctgttgttgcacagtataatgccagccagctcattactcagagagaggctgttagtagggaaataaggaagatcttgactgaaagggctaccaatttcaacattgctctggatgatgtgtcaattaccagccttacttttgggagggagttcacagctgcaattgaggccaaacaggtggctgcacaagaagctgagagagctaagtttgttgtggaaaaggctgagcaggacaagagaagtgctatcatcagagcacagggtgaggccacaagtgccaagttgattggtgaagctattgcgaacaacccggcattcatcacattgaggaagattgaagctgctagagaaatagcacataccatggcaaattcatcaaacaaagtttacttgagttccgatgatctgctgctgaaccttcaggacttgaacttggacgtgagcaagaagaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Band_7

Protein Analysis

324

Amino Acids

36.45

Weight (kDa)

9.54

Isoelectric Point (pI)

36.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001997)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G03860 AT1G03860 AT1G03860 AT2G20530 AT2G20530 AT4G28510 AT5G44140
fragaria_vesca	FvH4_3g23290 FvH4_3g23290 FvH4_3g23290 FvH4_3g23290 FvH4_6g26770 FvH4_6g26770
malus_domestica	MD03G1195500.v1.1 MD05G1030500.v1.1 MD11G1212000.v1.1
prunus_persica	Prupe.3G128200_v2.0.a1 Prupe.4G220500_v2.0.a1 Prupe.4G220500_v2.0.a1 Prupe.4G220500_v2.0.a1
pyrus_communis	pycom05g02170 pycom10g02030 pycom11g18700
rosa_chinensis	RchiOBHm_Chr0c19g0500161 RchiOBHm_Chr2g0128531 RchiOBHm_Chr5g0041011
rosa_laevigata	RLG00000018992 RLG00000034020
rosa_multiflora	Rmu_sc0005650.1_g000009 Rmu_sc0010062.1_g000004 Rmu_sc0033659.1_g000001
rosa_roxburghii	Rroxscaffold_1G00039690 Rroxscaffold_2G00115640 Rroxscaffold_2G00116110
rosa_rugosa	Rorug02G0278000 Rorug05G0189500 Rorug05G0189600
rosa_samantha	Rh2AG329600 Rh2CG316400 Rh2DG355900 Rh5BG280000 Rh5CG312100 Rh5DG288000
rosa_wichuraiana	Rw2G026720 Rw5G025880

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	477
AccIII	TCCGGA	1 cut(s)	286
AclWI	GGATC	2 cut(s)	46, 198
AcsI	RAATTY	1 cut(s)	889
AcuI	CTGAAG	1 cut(s)	923
AdeI	CACNNNGTG	1 cut(s)	782
AfaI	GTAC	1 cut(s)	125
AfiI	CCNNNNNNNGG	2 cut(s)	159, 211
AflII	CTTAAG	1 cut(s)	274
AgsI	TTSAA	5 cut(s)	60, 517, 619, 857, 949
AjiI	CACGTC	1 cut(s)	958
AjuI	GAANNNNNNNTTGG	2 cut(s)	89, 121
AluBI	AGCT	7 cut(s)	442, 550, 677, 713, 722, 815, 860
AluI	AGCT	7 cut(s)	442, 550, 677, 713, 722, 815, 860
Alw21I	GWGCWC	2 cut(s)	371, 778
AlwI	GGATC	2 cut(s)	46, 198
Aor13HI	TCCGGA	1 cut(s)	286
AoxI	GGCC	3 cut(s)	323, 687, 786
ApeKI	GCWGC	6 cut(s)	378, 442, 677, 701, 860, 928
ApoI	RAATTY	1 cut(s)	889
AsuC2I	CCSGG	1 cut(s)	830
AsuHPI	GGTGA	4 cut(s)	409, 479, 794, 821
BaeGI	GKGCMC	1 cut(s)	349
Bbv12I	GWGCWC	2 cut(s)	371, 778
BbvI	GCAGC	6 cut(s)	390, 429, 664, 688, 847, 915
BccI	CCATC	1 cut(s)	506
BceAI	ACGGC	1 cut(s)	366
BcnI	CCSGG	1 cut(s)	830
BfaI	CTAG	1 cut(s)	864
BfmI	CTRYAG	1 cut(s)	447
BfrI	CTTAAG	1 cut(s)	274
BglII	AGATCT	2 cut(s)	221, 591
BisI	GCNGC	6 cut(s)	379, 443, 678, 702, 861, 929
BlpI	GCTNAGC	1 cut(s)	744
BlsI	GCNGC	6 cut(s)	380, 444, 679, 703, 862, 930
Bme1390I	CCNGG	1 cut(s)	830
BmgBI	CACGTC	1 cut(s)	958
BmiI	GGNNCC	1 cut(s)	112
BmrFI	CCNGG	1 cut(s)	830
BplI	GAGNNNNNCTC	2 cut(s)	223, 255
BpmI	CTGGAG	1 cut(s)	233
Bpu10I	CCTNAGC	2 cut(s)	71, 178
Bpu1102I	GCTNAGC	1 cut(s)	744
BpuEI	CTTGAG	2 cut(s)	250, 931
BpuMI	CCSGG	1 cut(s)	830
BsaAI	YACGTR	1 cut(s)	169
BsaJI	CCNNGG	3 cut(s)	205, 311, 882
BsaWI	WCCGGW	1 cut(s)	286
Bsc4I	CCNNNNNNNGG	2 cut(s)	159, 211
Bse118I	RCCGGY	1 cut(s)	325
Bse3DI	GCAATG	3 cut(s)	99, 143, 621
BseAI	TCCGGA	1 cut(s)	286
BseDI	CCNNGG	3 cut(s)	205, 311, 882
BseGI	GGATG	2 cut(s)	306, 637
BseLI	CCNNNNNNNGG	2 cut(s)	159, 211
BseMI	GCAATG	3 cut(s)	99, 143, 621
BseMII	CTCAG	4 cut(s)	85, 572, 705, 735
BseSI	GKGCMC	1 cut(s)	349
BseXI	GCAGC	6 cut(s)	390, 429, 664, 688, 847, 915
BsgI	GTGCAG	1 cut(s)	687
BshFI	GGCC	3 cut(s)	325, 689, 788
BsiHKAI	GWGCWC	2 cut(s)	371, 778
BsiSI	CCGG	4 cut(s)	89, 287, 326, 830
BslFI	GGGAC	2 cut(s)	196, 307
BslI	CCNNNNNNNGG	2 cut(s)	159, 211
BsmFI	GGGAC	2 cut(s)	196, 307
BsmI	GAATGC	1 cut(s)	833
BsnI	GGCC	3 cut(s)	325, 689, 788
Bsp1286I	GDGCHC	3 cut(s)	349, 371, 778
Bsp13I	TCCGGA	1 cut(s)	286
Bsp1407I	TGTACA	1 cut(s)	123
Bsp143I	GATC	7 cut(s)	38, 190, 216, 221, 385, 591, 922
Bsp1720I	GCTNAGC	1 cut(s)	744
Bsp19I	CCATGG	2 cut(s)	311, 882
BspANI	GGCC	3 cut(s)	325, 689, 788
BspCNI	CTCAG	4 cut(s)	84, 571, 706, 736
BspEI	TCCGGA	1 cut(s)	286
BspHI	TCATGA	1 cut(s)	505
BspLI	GGNNCC	1 cut(s)	112
BspPI	GGATC	2 cut(s)	46, 198
BspTI	CTTAAG	1 cut(s)	274
BsrDI	GCAATG	3 cut(s)	99, 143, 621
BsrFI	RCCGGY	1 cut(s)	325
BsrGI	TGTACA	1 cut(s)	123
BssAI	RCCGGY	1 cut(s)	325
BssECI	CCNNGG	3 cut(s)	205, 311, 882
BssMI	GATC	7 cut(s)	38, 190, 216, 221, 385, 591, 922
BssT1I	CCWWGG	3 cut(s)	205, 311, 882
Bst4CI	ACNGT	2 cut(s)	451, 534
BstAFI	CTTAAG	1 cut(s)	274
BstAUI	TGTACA	1 cut(s)	123
BstBAI	YACGTR	1 cut(s)	169
BstC8I	GCNNGC	4 cut(s)	150, 236, 544, 548
BstDEI	CTNAG	8 cut(s)	71, 154, 178, 410, 558, 714, 723, 744
BstDSI	CCRYGG	2 cut(s)	311, 882
BstF5I	GGATG	2 cut(s)	306, 637
BstKTI	GATC	7 cut(s)	41, 193, 219, 224, 388, 594, 925
BstMBI	GATC	7 cut(s)	38, 190, 216, 221, 385, 591, 922
BstMWI	GCNNNNNNNGC	7 cut(s)	149, 375, 527, 686, 710, 719, 794
BstSCI	CCNGG	1 cut(s)	828
BstSFI	CTRYAG	1 cut(s)	447
BstSLI	GKGCMC	1 cut(s)	349
BstV1I	GCAGC	6 cut(s)	390, 429, 664, 688, 847, 915
BstX2I	RGATCY	3 cut(s)	190, 221, 591
BstXI	CCANNNNNNTGG	1 cut(s)	697
BstYI	RGATCY	3 cut(s)	190, 221, 591
BsuRI	GGCC	3 cut(s)	325, 689, 788
BtgI	CCRYGG	2 cut(s)	311, 882
BtrI	CACGTC	1 cut(s)	958
BtsCI	GGATG	2 cut(s)	306, 637
Cac8I	GCNNGC	4 cut(s)	150, 236, 544, 548
CciI	TCATGA	1 cut(s)	505
Cfr10I	RCCGGY	1 cut(s)	325
Csp6I	GTAC	1 cut(s)	124
CviAII	CATG	4 cut(s)	130, 312, 506, 883
CviQI	GTAC	1 cut(s)	124
DdeI	CTNAG	8 cut(s)	71, 154, 178, 410, 558, 714, 723, 744
DpnI	GATC	7 cut(s)	40, 192, 218, 223, 387, 593, 924
DpnII	GATC	7 cut(s)	38, 190, 216, 221, 385, 591, 922
DraI	TTTAAA	1 cut(s)	31
DraIII	CACNNNGTG	1 cut(s)	782
Eco130I	CCWWGG	3 cut(s)	205, 311, 882
Eco32I	GATATC	1 cut(s)	48
Eco57I	CTGAAG	1 cut(s)	923
EcoRV	GATATC	1 cut(s)	48
EcoT14I	CCWWGG	3 cut(s)	205, 311, 882
ErhI	CCWWGG	3 cut(s)	205, 311, 882
FaeI	CATG	4 cut(s)	133, 315, 509, 886
FaqI	GGGAC	2 cut(s)	196, 307
FatI	CATG	4 cut(s)	129, 311, 505, 882
Fnu4HI	GCNGC	6 cut(s)	379, 443, 678, 702, 861, 929
FokI	GGATG	2 cut(s)	293, 644
Fsp4HI	GCNGC	6 cut(s)	379, 443, 678, 702, 861, 929
FspBI	CTAG	1 cut(s)	864
GluI	GCNGC	6 cut(s)	379, 443, 678, 702, 861, 929
GsuI	CTGGAG	1 cut(s)	233
HaeIII	GGCC	3 cut(s)	325, 689, 788
HapII	CCGG	4 cut(s)	89, 287, 326, 830
Hin1II	CATG	4 cut(s)	133, 315, 509, 886
HinfI	GANTC	2 cut(s)	133, 486
HpaII	CCGG	4 cut(s)	89, 287, 326, 830
HphI	GGTGA	4 cut(s)	409, 479, 794, 821
Hpy166II	GTNNAC	4 cut(s)	84, 126, 672, 907
Hpy188I	TCNGA	5 cut(s)	221, 436, 561, 773, 919
Hpy188III	TCNNGA	7 cut(s)	17, 229, 287, 506, 595, 629, 941
Hpy8I	GTNNAC	4 cut(s)	84, 126, 672, 907
HpyAV	CCTTC	5 cut(s)	14, 500, 504, 511, 947
HpyCH4III	ACNGT	2 cut(s)	451, 534
HpyCH4IV	ACGT	2 cut(s)	168, 957
HpyCH4V	TGCA	4 cut(s)	143, 530, 680, 704
HpyF10VI	GCNNNNNNNGC	7 cut(s)	149, 375, 527, 686, 710, 719, 794
HpyF3I	CTNAG	8 cut(s)	71, 154, 178, 410, 558, 714, 723, 744
HpySE526I	ACGT	2 cut(s)	168, 957
Hsp92II	CATG	4 cut(s)	133, 315, 509, 886
Kpn2I	TCCGGA	1 cut(s)	286
Kzo9I	GATC	7 cut(s)	38, 190, 216, 221, 385, 591, 922
Lsp1109I	GCAGC	6 cut(s)	390, 429, 664, 688, 847, 915
MaeI	CTAG	1 cut(s)	864
MaeII	ACGT	2 cut(s)	168, 957
MaeIII	GTNAC	1 cut(s)	164
MalI	GATC	7 cut(s)	40, 192, 218, 223, 387, 593, 924
MboI	GATC	7 cut(s)	38, 190, 216, 221, 385, 591, 922
MboII	GAAGA	2 cut(s)	601, 862
MfeI	CAATTG	1 cut(s)	681
MflI	RGATCY	3 cut(s)	190, 221, 591
MhlI	GDGCHC	3 cut(s)	349, 371, 778
MluCI	AATT	7 cut(s)	60, 115, 472, 613, 642, 681, 889
MlyI	GAGTC	1 cut(s)	495
MroI	TCCGGA	1 cut(s)	286
MseI	TTAA	2 cut(s)	30, 275
MspA1I	CMGCKG	2 cut(s)	442, 677
MspCI	CTTAAG	1 cut(s)	274
MspI	CCGG	4 cut(s)	89, 287, 326, 830
MspR9I	CCNGG	1 cut(s)	830
MunI	CAATTG	1 cut(s)	681
Mva1269I	GAATGC	1 cut(s)	833
MwoI	GCNNNNNNNGC	7 cut(s)	149, 375, 527, 686, 710, 719, 794
NciI	CCSGG	1 cut(s)	830
NcoI	CCATGG	2 cut(s)	311, 882
NdeII	GATC	7 cut(s)	38, 190, 216, 221, 385, 591, 922
NlaIII	CATG	4 cut(s)	133, 315, 509, 886
NlaIV	GGNNCC	1 cut(s)	112
PagI	TCATGA	1 cut(s)	505
PctI	GAATGC	1 cut(s)	833
PfeI	GAWTC	1 cut(s)	133
PkrI	GCNGC	6 cut(s)	380, 444, 679, 703, 862, 930
PleI	GAGTC	1 cut(s)	494
PpsI	GAGTC	1 cut(s)	494
Ppu21I	YACGTR	1 cut(s)	169
PsiI	TTATAA	1 cut(s)	477
PspN4I	GGNNCC	1 cut(s)	112
PsuI	RGATCY	3 cut(s)	190, 221, 591
PvuII	CAGCTG	2 cut(s)	442, 677
RsaI	GTAC	1 cut(s)	125
RsaNI	GTAC	1 cut(s)	124
SaqAI	TTAA	2 cut(s)	30, 275
SatI	GCNGC	6 cut(s)	379, 443, 678, 702, 861, 929
Sau3AI	GATC	7 cut(s)	38, 190, 216, 221, 385, 591, 922
SchI	GAGTC	1 cut(s)	495
ScrFI	CCNGG	1 cut(s)	830
SduI	GDGCHC	3 cut(s)	349, 371, 778
SfcI	CTRYAG	1 cut(s)	447
SmlI	CTYRAG	3 cut(s)	229, 274, 910
SmoI	CTYRAG	3 cut(s)	229, 274, 910
Sse9I	AATT	7 cut(s)	60, 115, 472, 613, 642, 681, 889
SspMI	CTAG	1 cut(s)	864
StyD4I	CCNGG	1 cut(s)	828
StyI	CCWWGG	3 cut(s)	205, 311, 882
TaaI	ACNGT	2 cut(s)	451, 534
TaiI	ACGT	2 cut(s)	171, 960
TaqI	TCGA	2 cut(s)	136, 457
TasI	AATT	7 cut(s)	60, 115, 472, 613, 642, 681, 889
TatI	WGTACW	1 cut(s)	123
TfiI	GAWTC	1 cut(s)	133
Tru1I	TTAA	2 cut(s)	30, 275
Tru9I	TTAA	2 cut(s)	30, 275
TseI	GCWGC	6 cut(s)	378, 442, 677, 701, 860, 928
TspDTI	ATGAA	6 cut(s)	110, 146, 494, 522, 826, 882
Vha464I	CTTAAG	1 cut(s)	274
XapI	RAATTY	1 cut(s)	889
XspI	CTAG	1 cut(s)	864

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.