Rmu_sc0010817.1_g000006

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010817.1
Physical Location & Seq
Reverse (-)
13822 .. 15090
1269 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010817.1_g000006.1.cds

Sequence Viewer

Length: 1269 bp
atggaggacgacgacaacaactcgagtaaaatcataagagaaaacatgtcaggatggtccgaattaccaaaggaactctgtcaacatatcctatcaacatccaccctcaaaaccatcatgcgctttaaagcagtttgtccctcttggtctgctgcagttgatgaaatcaccaagtcaccatccttcacttggctacccgaaacagcgtggctcgttcttccccgagatctgaataaaggtgaggccattgatgggtctaggttttacagtcttaaaggaaacttttacaactcgaacataaacatgcccgaggagtccagagatgcagtttgccttggatcctctcacggttggctagttttgttgaacaaccagctcgagtttatgatctcaactccattcttatctggaattcaacttcccctgccaccactcaagacttttccagatatacttggcattacatatcagaaaggtactacttatgcatacaatattgttgatcacttcacattagcatgcaaaacttctgatgaggctaaaaggcctccgagtgataaattcttggatttcacttctgtgaggcatttggcaagcaagatgagagccaaggctgggttgtcttcacgtccgacatgcagcaacaaagacaagattggagtcatggtgatgtacatctttgaagacagagataattgcaggtacaacagccttgctttctgcacaacatctgattataagtggacaaaacttgaggagcgcagatggtacaaagaaatcatggggtgtggtaatgagttctatgtcttaaaggaagactatagtgttgatgtctgggatttcagcacatcttccattcccatgaagaagatggaaatcaaacctgttgcatgtgcaatacttgccgaagtaagaggaaggtctcccaaggtttacatgatcaaaacagtggggactggtctaatgctggtagtggaatatgttcatatctcacaaattcaattccgtgtttataagctggaggggacaactcctgtgtggcaggaggtgcaatcgattgggagtaatgccttggttttaggttcgaacaattccatagtaatgtcattacatgattccctacgctgtgatgatgattcgatttactatgcgcagaagtcaagacctgaatcctatagtttacatgtgtttagtttgaaagacaattcaaggaaaaaagtttgtgaactgccagtggactttgaaccactagctttttcgggatcctaa

Protein Analysis

422

Amino Acids

47.93

Weight (kDa)

6.67

Isoelectric Point (pI)

50.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 738, 1014
Acc16I TGCGCA 1 cut(s) 1152
Acc36I ACCTGC 1 cut(s) 690
AclWI GGATC 3 cut(s) 333, 346, 1257
AcsI RAATTY 3 cut(s) 411, 560, 996
AfaI GTAC 4 cut(s) 478, 674, 704, 770
AfiI CCNNNNNNNGG 3 cut(s) 189, 252, 615
AflIII ACRYGT 2 cut(s) 45, 1183
AgsI TTSAA 7 cut(s) 367, 416, 683, 1001, 1198, 1209, 1244
AjiI CACGTC 1 cut(s) 629
AleI CACNNNNGTG 1 cut(s) 578
AluBI AGCT 3 cut(s) 376, 1018, 1253
AluI AGCT 3 cut(s) 376, 1018, 1253
Alw26I GTCTC 1 cut(s) 927
AlwI GGATC 3 cut(s) 333, 346, 1257
Ama87I CYCGRG 4 cut(s) 22, 222, 308, 377
AoxI GGCC 2 cut(s) 243, 545
ApeKI GCWGC 2 cut(s) 152, 639
ApoI RAATTY 3 cut(s) 411, 560, 996
Asp700I GAANNNNTTC 1 cut(s) 981
AspLEI GCGC 3 cut(s) 123, 762, 1153
AspS9I GGNCC 1 cut(s) 57
AsuHPI GGTGA 4 cut(s) 160, 168, 251, 679
AsuII TTCGAA 1 cut(s) 1085
AvaI CYCGRG 4 cut(s) 22, 222, 308, 377
AvaII GGWCC 1 cut(s) 57
BamHI GGATCC 2 cut(s) 338, 1262
BbsI GAAGAC 3 cut(s) 615, 690, 822
BbvI GCAGC 2 cut(s) 139, 651
BccI CCATC 6 cut(s) 48, 122, 187, 245, 759, 865
BclI TGATCA 2 cut(s) 502, 939
BcoDI GTCTC 1 cut(s) 927
BfaI CTAG 3 cut(s) 258, 356, 1250
BfmI CTRYAG 3 cut(s) 153, 820, 1174
BfuAI ACCTGC 1 cut(s) 690
BglII AGATCT 1 cut(s) 226
BisI GCNGC 2 cut(s) 153, 640
BlsI GCNGC 2 cut(s) 154, 641
Bme18I GGWCC 1 cut(s) 57
BmeT110I CYCGRG 4 cut(s) 22, 222, 308, 377
BmgBI CACGTC 1 cut(s) 629
BmgT120I GGNCC 1 cut(s) 57
BmiI GGNNCC 2 cut(s) 340, 1264
BmsI GCATC 1 cut(s) 313
BpiI GAAGAC 3 cut(s) 615, 690, 822
BpmI CTGGAG 1 cut(s) 1040
Bpu14I TTCGAA 1 cut(s) 1085
BpuEI CTTGAG 2 cut(s) 419, 773
Bsa29I ATCGAT 1 cut(s) 1055
BsaBI GATNNNNATC 2 cut(s) 674, 875
BsaI GGTCTC 1 cut(s) 927
BsaJI CCNNGG 5 cut(s) 309, 334, 609, 927, 1071
BsaXI ACNNNNNCTCC 2 cut(s) 651, 681
Bsc4I CCNNNNNNNGG 3 cut(s) 189, 252, 615
Bse1I ACTGG 2 cut(s) 961, 1232
Bse8I GATNNNNATC 2 cut(s) 674, 875
BseCI ATCGAT 1 cut(s) 1055
BseDI CCNNGG 5 cut(s) 309, 334, 609, 927, 1071
BseGI GGATG 3 cut(s) 59, 98, 179
BseJI GATNNNNATC 2 cut(s) 674, 875
BseLI CCNNNNNNNGG 3 cut(s) 189, 252, 615
BseNI ACTGG 2 cut(s) 961, 1232
BseRI GAGGAG 2 cut(s) 326, 770
BseXI GCAGC 2 cut(s) 139, 651
BseYI CCCAGC 1 cut(s) 614
BsgI GTGCAG 1 cut(s) 706
BshFI GGCC 2 cut(s) 245, 547
BshVI ATCGAT 1 cut(s) 1055
BsiHKCI CYCGRG 4 cut(s) 22, 222, 308, 377
BslFI GGGAC 3 cut(s) 123, 967, 1039
BslI CCNNNNNNNGG 3 cut(s) 189, 252, 615
BsmAI GTCTC 1 cut(s) 927
BsmFI GGGAC 3 cut(s) 123, 967, 1039
BsnI GGCC 2 cut(s) 245, 547
Bso31I GGTCTC 1 cut(s) 927
BsoBI CYCGRG 4 cut(s) 22, 222, 308, 377
Bsp119I TTCGAA 1 cut(s) 1085
Bsp1407I TGTACA 1 cut(s) 672
Bsp143I GATC 6 cut(s) 226, 338, 387, 502, 939, 1262
BspANI GGCC 2 cut(s) 245, 547
BspDI ATCGAT 1 cut(s) 1055
BspLI GGNNCC 2 cut(s) 340, 1264
BspMAI CTGCAG 1 cut(s) 157
BspMI ACCTGC 1 cut(s) 690
BspPI GGATC 3 cut(s) 333, 346, 1257
BspT104I TTCGAA 1 cut(s) 1085
BspTNI GGTCTC 1 cut(s) 927
BsrGI TGTACA 1 cut(s) 672
BsrI ACTGG 2 cut(s) 961, 1232
BssECI CCNNGG 5 cut(s) 309, 334, 609, 927, 1071
BssMI GATC 6 cut(s) 226, 338, 387, 502, 939, 1262
BssT1I CCWWGG 4 cut(s) 334, 609, 927, 1071
Bst4CI ACNGT 3 cut(s) 269, 350, 949
BstAPI GCANNNNNTGC 2 cut(s) 902, 1048
BstAUI TGTACA 1 cut(s) 672
BstBI TTCGAA 1 cut(s) 1085
BstC8I GCNNGC 2 cut(s) 520, 595
BstF5I GGATG 3 cut(s) 59, 98, 179
BstHHI GCGC 3 cut(s) 123, 762, 1153
BstKTI GATC 6 cut(s) 229, 341, 390, 505, 942, 1265
BstMAI GTCTC 1 cut(s) 927
BstMBI GATC 6 cut(s) 226, 338, 387, 502, 939, 1262
BstMWI GCNNNNNNNGC 2 cut(s) 902, 1048
BstNSI RCATGY 6 cut(s) 49, 307, 522, 639, 894, 1187
BstSFI CTRYAG 3 cut(s) 153, 820, 1174
BstV1I GCAGC 2 cut(s) 139, 651
BstV2I GAAGAC 3 cut(s) 615, 690, 822
BstX2I RGATCY 3 cut(s) 226, 338, 1262
BstYI RGATCY 3 cut(s) 226, 338, 1262
Bsu15I ATCGAT 1 cut(s) 1055
BsuRI GGCC 2 cut(s) 245, 547
BsuTUI ATCGAT 1 cut(s) 1055
BtrI CACGTC 1 cut(s) 629
BtsCI GGATG 3 cut(s) 59, 98, 179
BtsIMutI CAGTG 2 cut(s) 954, 1239
BveI ACCTGC 1 cut(s) 690
Cac8I GCNNGC 2 cut(s) 520, 595
CfoI GCGC 3 cut(s) 123, 762, 1153
Cfr13I GGNCC 1 cut(s) 57
ClaI ATCGAT 1 cut(s) 1055
Csp6I GTAC 4 cut(s) 477, 673, 703, 769
CviQI GTAC 4 cut(s) 477, 673, 703, 769
DpnI GATC 6 cut(s) 228, 340, 389, 504, 941, 1264
DpnII GATC 6 cut(s) 226, 338, 387, 502, 939, 1262
DraI TTTAAA 1 cut(s) 127
Eco130I CCWWGG 4 cut(s) 334, 609, 927, 1071
Eco147I AGGCCT 1 cut(s) 547
Eco31I GGTCTC 1 cut(s) 927
Eco47I GGWCC 1 cut(s) 57
Eco88I CYCGRG 4 cut(s) 22, 222, 308, 377
EcoRI GAATTC 1 cut(s) 411
EcoT14I CCWWGG 4 cut(s) 334, 609, 927, 1071
EcoT22I ATGCAT 1 cut(s) 490
ErhI CCWWGG 4 cut(s) 334, 609, 927, 1071
FaqI GGGAC 3 cut(s) 123, 967, 1039
FbaI TGATCA 2 cut(s) 502, 939
Fnu4HI GCNGC 2 cut(s) 153, 640
FokI GGATG 3 cut(s) 66, 85, 166
Fsp4HI GCNGC 2 cut(s) 153, 640
FspBI CTAG 3 cut(s) 258, 356, 1250
FspI TGCGCA 1 cut(s) 1152
GlaI GCGC 3 cut(s) 122, 761, 1152
GluI GCNGC 2 cut(s) 153, 640
GsaI CCCAGC 1 cut(s) 618
GsuI CTGGAG 1 cut(s) 1040
HaeIII GGCC 2 cut(s) 245, 547
HhaI GCGC 3 cut(s) 123, 762, 1153
Hin6I GCGC 3 cut(s) 121, 760, 1151
HinP1I GCGC 3 cut(s) 121, 760, 1151
HincII GTYRAC 1 cut(s) 83
HindII GTYRAC 1 cut(s) 83
HinfI GANTC 5 cut(s) 314, 660, 1115, 1136, 1169
HphI GGTGA 4 cut(s) 160, 168, 251, 679
Hpy166II GTNNAC 6 cut(s) 83, 744, 934, 1181, 1226, 1237
Hpy188I TCNGA 7 cut(s) 61, 231, 471, 532, 552, 633, 733
Hpy188III TCNNGA 7 cut(s) 51, 318, 408, 436, 446, 1161, 1260
Hpy8I GTNNAC 6 cut(s) 83, 744, 934, 1181, 1226, 1237
Hpy99I CGWCG 1 cut(s) 14
HpyAV CCTTC 2 cut(s) 193, 912
HpyCH4III ACNGT 3 cut(s) 269, 350, 949
HpyCH4IV ACGT 1 cut(s) 628
HpyF10VI GCNNNNNNNGC 2 cut(s) 902, 1048
HpySE526I ACGT 1 cut(s) 628
HspAI GCGC 3 cut(s) 121, 760, 1151
Ksp22I TGATCA 2 cut(s) 502, 939
Kzo9I GATC 6 cut(s) 226, 338, 387, 502, 939, 1262
LmnI GCTCC 1 cut(s) 757
Lsp1109I GCAGC 2 cut(s) 139, 651
LweI GCATC 1 cut(s) 313
MaeI CTAG 3 cut(s) 258, 356, 1250
MaeII ACGT 1 cut(s) 628
MaeIII GTNAC 1 cut(s) 174
MalI GATC 6 cut(s) 228, 340, 389, 504, 941, 1264
MboI GATC 6 cut(s) 226, 338, 387, 502, 939, 1262
MboII GAAGA 7 cut(s) 209, 615, 695, 827, 843, 877, 880
MflI RGATCY 3 cut(s) 226, 338, 1262
MluCI AATT 8 cut(s) 62, 411, 560, 694, 996, 1001, 1090, 1204
MlyI GAGTC 2 cut(s) 323, 669
MmeI TCCRAC 1 cut(s) 656
Mph1103I ATGCAT 1 cut(s) 490
MroXI GAANNNNTTC 1 cut(s) 981
MseI TTAA 3 cut(s) 126, 273, 809
MslI CAYNNNNRTG 6 cut(s) 302, 517, 578, 668, 860, 1100
MwoI GCNNNNNNNGC 2 cut(s) 902, 1048
NdeII GATC 6 cut(s) 226, 338, 387, 502, 939, 1262
NlaIV GGNNCC 2 cut(s) 340, 1264
NmuCI GTSAC 1 cut(s) 174
NsbI TGCGCA 1 cut(s) 1152
NsiI ATGCAT 1 cut(s) 490
NspI RCATGY 6 cut(s) 49, 307, 522, 639, 894, 1187
NspV TTCGAA 1 cut(s) 1085
OliI CACNNNNGTG 1 cut(s) 578
PaeI GCATGC 1 cut(s) 522
PaeR7I CTCGAG 2 cut(s) 22, 377
PceI AGGCCT 1 cut(s) 547
PciI ACATGT 2 cut(s) 45, 1183
PdmI GAANNNNTTC 1 cut(s) 981
PfeI GAWTC 3 cut(s) 1115, 1136, 1169
PkrI GCNGC 2 cut(s) 154, 641
PleI GAGTC 2 cut(s) 322, 668
PpsI GAGTC 2 cut(s) 322, 668
PscI ACATGT 2 cut(s) 45, 1183
PsiI TTATAA 2 cut(s) 738, 1014
PspFI CCCAGC 1 cut(s) 614
PspN4I GGNNCC 2 cut(s) 340, 1264
PspPI GGNCC 1 cut(s) 57
PspXI VCTCGAGB 2 cut(s) 22, 377
PstI CTGCAG 1 cut(s) 157
PsuI RGATCY 3 cut(s) 226, 338, 1262
RsaI GTAC 4 cut(s) 478, 674, 704, 770
RsaNI GTAC 4 cut(s) 477, 673, 703, 769
RseI CAYNNNNRTG 6 cut(s) 302, 517, 578, 668, 860, 1100
SaqAI TTAA 3 cut(s) 126, 273, 809
SatI GCNGC 2 cut(s) 153, 640
Sau3AI GATC 6 cut(s) 226, 338, 387, 502, 939, 1262
Sau96I GGNCC 1 cut(s) 57
SchI GAGTC 2 cut(s) 323, 669
SfaNI GCATC 1 cut(s) 313
SfcI CTRYAG 3 cut(s) 153, 820, 1174
Sfr274I CTCGAG 2 cut(s) 22, 377
SfuI TTCGAA 1 cut(s) 1085
SinI GGWCC 1 cut(s) 57
SlaI CTCGAG 2 cut(s) 22, 377
SmiMI CAYNNNNRTG 6 cut(s) 302, 517, 578, 668, 860, 1100
SmlI CTYRAG 4 cut(s) 22, 377, 434, 752
SmoI CTYRAG 4 cut(s) 22, 377, 434, 752
SphI GCATGC 1 cut(s) 522
Sse9I AATT 8 cut(s) 62, 411, 560, 694, 996, 1001, 1090, 1204
SseBI AGGCCT 1 cut(s) 547
SspI AATATT 1 cut(s) 496
SspMI CTAG 3 cut(s) 258, 356, 1250
StuI AGGCCT 1 cut(s) 547
StyI CCWWGG 4 cut(s) 334, 609, 927, 1071
TaaI ACNGT 3 cut(s) 269, 350, 949
TaiI ACGT 1 cut(s) 631
TaqI TCGA 6 cut(s) 23, 293, 378, 1055, 1085, 1139
TasI AATT 8 cut(s) 62, 411, 560, 694, 996, 1001, 1090, 1204
TatI WGTACW 1 cut(s) 672
TfiI GAWTC 3 cut(s) 1115, 1136, 1169
Tru1I TTAA 3 cut(s) 126, 273, 809
Tru9I TTAA 3 cut(s) 126, 273, 809
TscAI CASTG 2 cut(s) 954, 1239
TseFI GTSAC 1 cut(s) 174
TseI GCWGC 2 cut(s) 152, 639
Tsp45I GTSAC 1 cut(s) 174
TspDTI ATGAA 3 cut(s) 177, 878, 974
TspGWI ACGGA 1 cut(s) 995
TspRI CASTG 2 cut(s) 954, 1239
VpaK11BI GGWCC 1 cut(s) 57
XapI RAATTY 3 cut(s) 411, 560, 996
XceI RCATGY 6 cut(s) 49, 307, 522, 639, 894, 1187
XcmI CCANNNNNNNNNTGG 2 cut(s) 186, 868
XhoI CTCGAG 2 cut(s) 22, 377
XmnI GAANNNNTTC 1 cut(s) 981
XspI CTAG 3 cut(s) 258, 356, 1250
Zsp2I ATGCAT 1 cut(s) 490
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.