Rmu_sc0015767.1_g000001

5'-3' exoribonuclease

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015767.1
Physical Location & Seq
Reverse (-)
262 .. 528
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015767.1_g000001.1.cds

Sequence Viewer

Length: 267 bp
atgggagttccagctttctacagatggctagcggagaagtatccactcgtcgtcgtcatcgatgtggtggaagaagaactggttgtaatcgacgacatttcgattccggtcgacactagtaagccaaaccctaacggcgagtatgacaatctatacctcgacatgaatgggattattctcaacatcatcaaaaaccatcaatctctcatcaaaacaccatgggtctctcatcgaaacaccatctgttatcaaacacatctcgattag

Protein Analysis

88

Amino Acids

10.14

Weight (kDa)

4.76

Isoelectric Point (pI)

36.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 111
AciI CCGC 1 cut(s) 32
AhlI ACTAGT 1 cut(s) 116
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
Alw26I GTCTC 1 cut(s) 229
AsuNHI GCTAGC 1 cut(s) 28
BccI CCATC 3 cut(s) 18, 204, 248
BceAI ACGGC 1 cut(s) 151
BciVI GTATCC 1 cut(s) 51
BcoDI GTCTC 1 cut(s) 229
BcuI ACTAGT 1 cut(s) 116
BfaI CTAG 2 cut(s) 29, 117
BfmI CTRYAG 1 cut(s) 19
BfuI GTATCC 1 cut(s) 51
BmtI GCTAGC 1 cut(s) 32
Bsa29I ATCGAT 1 cut(s) 60
BsaI GGTCTC 1 cut(s) 229
BsaJI CCNNGG 1 cut(s) 218
BsaWI WCCGGW 1 cut(s) 106
Bse1I ACTGG 1 cut(s) 84
BseCI ATCGAT 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 218
BseNI ACTGG 1 cut(s) 84
Bsh1285I CGRYCG 1 cut(s) 111
BshVI ATCGAT 1 cut(s) 60
BsiEI CGRYCG 1 cut(s) 111
BsiSI CCGG 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 229
Bso31I GGTCTC 1 cut(s) 229
Bsp19I CCATGG 1 cut(s) 218
BspACI CCGC 1 cut(s) 32
BspDI ATCGAT 1 cut(s) 60
BspOI GCTAGC 1 cut(s) 32
BspTNI GGTCTC 1 cut(s) 229
BsrI ACTGG 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 218
BssT1I CCWWGG 1 cut(s) 218
BstC8I GCNNGC 1 cut(s) 30
BstDSI CCRYGG 1 cut(s) 218
BstMAI GTCTC 1 cut(s) 229
BstMCI CGRYCG 1 cut(s) 111
BstSFI CTRYAG 1 cut(s) 19
Bsu15I ATCGAT 1 cut(s) 60
BsuI GTATCC 1 cut(s) 51
BsuTUI ATCGAT 1 cut(s) 60
BtgI CCRYGG 1 cut(s) 218
Cac8I GCNNGC 1 cut(s) 30
ClaI ATCGAT 1 cut(s) 60
CviAII CATG 2 cut(s) 163, 219
CviJI RGCY 3 cut(s) 14, 28, 124
CviKI_1 RGCY 3 cut(s) 14, 28, 124
Eco130I CCWWGG 1 cut(s) 218
Eco31I GGTCTC 1 cut(s) 229
EcoT14I CCWWGG 1 cut(s) 218
ErhI CCWWGG 1 cut(s) 218
FaeI CATG 2 cut(s) 166, 222
FaiI YATR 4 cut(s) 144, 154, 164, 220
FatI CATG 2 cut(s) 162, 218
FblI GTMKAC 1 cut(s) 111
FspBI CTAG 2 cut(s) 29, 117
HapII CCGG 1 cut(s) 107
Hin1II CATG 2 cut(s) 166, 222
HincII GTYRAC 1 cut(s) 112
HindII GTYRAC 1 cut(s) 112
HinfI GANTC 1 cut(s) 103
HpaII CCGG 1 cut(s) 107
Hpy166II GTNNAC 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 260
Hpy8I GTNNAC 1 cut(s) 112
Hpy99I CGWCG 3 cut(s) 53, 56, 95
Hsp92II CATG 2 cut(s) 166, 222
LpnPI CCDG 3 cut(s) 24, 65, 120
MaeI CTAG 2 cut(s) 29, 117
MboII GAAGA 2 cut(s) 83, 86
MnlI CCTC 1 cut(s) 167
MslI CAYNNNNRTG 1 cut(s) 62
MspI CCGG 1 cut(s) 107
NcoI CCATGG 1 cut(s) 218
NheI GCTAGC 1 cut(s) 28
NlaIII CATG 2 cut(s) 166, 222
PcsI WCGNNNNNNNCGW 1 cut(s) 57
PfeI GAWTC 1 cut(s) 103
RseI CAYNNNNRTG 1 cut(s) 62
SalI GTCGAC 1 cut(s) 110
SetI ASST 2 cut(s) 16, 159
SfcI CTRYAG 1 cut(s) 19
SmiMI CAYNNNNRTG 1 cut(s) 62
SpeI ACTAGT 1 cut(s) 116
SsiI CCGC 1 cut(s) 32
SspMI CTAG 2 cut(s) 29, 117
StyI CCWWGG 1 cut(s) 218
TaqI TCGA 7 cut(s) 60, 90, 101, 111, 159, 232, 261
TfiI GAWTC 1 cut(s) 103
TspDTI ATGAA 1 cut(s) 179
XmiI GTMKAC 1 cut(s) 111
XspI CTAG 2 cut(s) 29, 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.