Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0034909.1

Orthogroup ID

OG0002873

Physical Location & Seq

Genomic Coordinates Forward (+)

861 .. 1097

Gene Structure 237 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0034909.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 237 bp

atgggagttccagctttctatagatggctagcggagaagtatccactcgtcgtcgtcgatgtggtggaagaagaatcggttgtaatcgacgacggttcgattccggtccacaccagtaagccaaattctaacggcgagtatgacaatctgtacctcgatatgaatgggattattctcaacatcatcaaaaaccatcaatctctcatcaaaacaccttctgttatcaaacacatctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000966 GO:0000967 GO:0003674 GO:0003824 GO:0004518 GO:0004527 GO:0004532 GO:0004534 GO:0004540 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006139 GO:0006364 GO:0006396 GO:0006401 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0008409 GO:0009056 GO:0009057 GO:0009893 GO:0009987 GO:0010467 GO:0010468 GO:0010586 GO:0010587 GO:0010604 GO:0010628 GO:0016070 GO:0016072 GO:0016075 GO:0016787 GO:0016788 GO:0016796 GO:0016896 GO:0019222 GO:0019439 GO:0022613 GO:0034470 GO:0034471 GO:0034641 GO:0034655 GO:0034660 GO:0034661 GO:0042254 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043632 GO:0043633 GO:0043634 GO:0044085 GO:0044237 GO:0044238 GO:0044248 GO:0044260 GO:0044265 GO:0044270 GO:0044424 GO:0044464 GO:0046483 GO:0046700 GO:0048518 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0060147 GO:0060149 GO:0060255 GO:0060968 GO:0060969 GO:0065007 GO:0071025 GO:0071027 GO:0071029 GO:0071035 GO:0071046 GO:0071704 GO:0071840 GO:0090304 GO:0090305 GO:0090501 GO:0090503 GO:0140098 GO:1901360 GO:1901361 GO:1901575

KEGG Pathways

Metabolic & Signaling

ko03008 ko03018 map03008 map03018

Pfam Domains

Protein Families

XRN_N zf-CCHC

Protein Analysis

78

Amino Acids

8.78

Weight (kDa)

5.1

Isoelectric Point (pI)

52.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002873)

Species	Orthologous Gene IDs
malus_domestica	MD15G1369000.v1.1
rosa_chinensis	RchiOBHm_Chr2g0158691 RchiOBHm_Chr3g0461771 RchiOBHm_Chr3g0477511 RchiOBHm_Chr4g0391611 RchiOBHm_Chr5g0060841 RchiOBHm_Chr5g0074511 RchiOBHm_Chr5g0074521 RchiOBHm_Chr6g0248211
rosa_laevigata	RLG00000001875 RLG00000032521
rosa_multiflora	Rmu_sc0001803.1_g000035 Rmu_sc0002942.1_g000044 Rmu_sc0005455.1_g000008 Rmu_sc0006619.1_g000001 Rmu_sc0015767.1_g000001 Rmu_sc0034909.1_g000001
rosa_roxburghii	Rroxscaffold_2G00094060 Rroxscaffold_2G00116020 Rroxscaffold_3G00235080 Rroxscaffold_5G00358150 Rroxscaffold_5G00359750
rosa_rugosa	Rorug05G0328100 Rorug05G0352400 Rorug07G0018800 Rorug07G0018900
rosa_samantha	Rh2AG426900 Rh2BG244900 Rh2BG245000 Rh2BG415100 Rh3BG245300 Rh3CG117000 Rh3CG370200 Rh3CG370300 Rh4DG044300 Rh5DG334900 Rh5DG403500 Rh6CG125700 Rh7CG192300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	32
AcsI	RAATTY	1 cut(s)	124
AfaI	GTAC	1 cut(s)	152
AluBI	AGCT	1 cut(s)	14
AluI	AGCT	1 cut(s)	14
ApoI	RAATTY	1 cut(s)	124
AspS9I	GGNCC	1 cut(s)	106
AsuNHI	GCTAGC	1 cut(s)	28
AvaII	GGWCC	1 cut(s)	106
BccI	CCATC	2 cut(s)	18, 201
BceAI	ACGGC	1 cut(s)	148
BciVI	GTATCC	1 cut(s)	51
BfaI	CTAG	2 cut(s)	29, 235
BfmI	CTRYAG	1 cut(s)	19
BfuI	GTATCC	1 cut(s)	51
Bme18I	GGWCC	1 cut(s)	106
BmgT120I	GGNCC	1 cut(s)	106
BmtI	GCTAGC	1 cut(s)	32
BsaWI	WCCGGW	1 cut(s)	103
Bse1I	ACTGG	1 cut(s)	114
BseNI	ACTGG	1 cut(s)	114
BsiSI	CCGG	1 cut(s)	104
BspACI	CCGC	1 cut(s)	32
BspOI	GCTAGC	1 cut(s)	32
BsrI	ACTGG	1 cut(s)	114
Bst4CI	ACNGT	1 cut(s)	95
BstC8I	GCNNGC	1 cut(s)	30
BstSFI	CTRYAG	1 cut(s)	19
BsuI	GTATCC	1 cut(s)	51
Cac8I	GCNNGC	1 cut(s)	30
Cfr13I	GGNCC	1 cut(s)	106
Csp6I	GTAC	1 cut(s)	151
CviJI	RGCY	3 cut(s)	14, 28, 121
CviKI_1	RGCY	3 cut(s)	14, 28, 121
CviQI	GTAC	1 cut(s)	151
Eco47I	GGWCC	1 cut(s)	106
FaiI	YATR	3 cut(s)	21, 141, 161
FspBI	CTAG	2 cut(s)	29, 235
HapII	CCGG	1 cut(s)	104
HinfI	GANTC	2 cut(s)	74, 100
HpaII	CCGG	1 cut(s)	104
Hpy166II	GTNNAC	1 cut(s)	109
Hpy8I	GTNNAC	1 cut(s)	109
Hpy99I	CGWCG	5 cut(s)	53, 56, 59, 92, 95
HpyAV	CCTTC	1 cut(s)	225
HpyCH4III	ACNGT	1 cut(s)	95
LpnPI	CCDG	3 cut(s)	24, 117, 127
MaeI	CTAG	2 cut(s)	29, 235
MboII	GAAGA	2 cut(s)	80, 83
MluCI	AATT	1 cut(s)	124
MnlI	CCTC	1 cut(s)	164
MspI	CCGG	1 cut(s)	104
NheI	GCTAGC	1 cut(s)	28
PcsI	WCGNNNNNNNCGW	1 cut(s)	54
PfeI	GAWTC	2 cut(s)	74, 100
PspPI	GGNCC	1 cut(s)	106
RsaI	GTAC	1 cut(s)	152
RsaNI	GTAC	1 cut(s)	151
Sau96I	GGNCC	1 cut(s)	106
SetI	ASST	3 cut(s)	16, 156, 217
SfcI	CTRYAG	1 cut(s)	19
SgeI	CNNG	7 cut(s)	23, 41, 59, 116, 126, 148, 167
SinI	GGWCC	1 cut(s)	106
Sse9I	AATT	1 cut(s)	124
SsiI	CCGC	1 cut(s)	32
SspMI	CTAG	2 cut(s)	29, 235
TaaI	ACNGT	1 cut(s)	95
TaqI	TCGA	4 cut(s)	57, 87, 98, 156
TasI	AATT	1 cut(s)	124
TfiI	GAWTC	2 cut(s)	74, 100
TspDTI	ATGAA	1 cut(s)	176
VpaK11BI	GGWCC	1 cut(s)	106
XapI	RAATTY	1 cut(s)	124
XspI	CTAG	2 cut(s)	29, 235

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.