Rroxscaffold_5G00358150

Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type IV subfamily

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
38206516 .. 38207736
1221 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00358150.1

Sequence Viewer

Length: 234 bp
ATGGACTTCTATAGTAAAGAAAATGCAAGACCGGATGATTCAACCATTGAATATAATGGTTTTAAGATAGCAAAATCATCTATCGGGGCTGATAGGGAGGTGATGCTCGAGCGAGTAGCAGAGAAGATGGAAAAGGACTTGATCATGGTTGGTGCTACGGTTGTGGAGGACAAATTGCAAAAAAGGATGCCCCAATGCATATACAATCTTGCACAACCTGATCTCAAGATCTAG

Protein Analysis

77

Amino Acids

8.83

Weight (kDa)

5.07

Isoelectric Point (pI)

34.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 42, 50
Ama87I CYCGRG 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 112
AvaI CYCGRG 1 cut(s) 107
BccI CCATC 1 cut(s) 121
BclI TGATCA 1 cut(s) 141
BfaI CTAG 1 cut(s) 232
BfmI CTRYAG 1 cut(s) 10
BglII AGATCT 1 cut(s) 228
BmeT110I CYCGRG 1 cut(s) 107
BmsI GCATC 2 cut(s) 93, 177
BpuEI CTTGAG 1 cut(s) 209
BsaWI WCCGGW 1 cut(s) 31
BseGI GGATG 2 cut(s) 40, 192
BsiHKCI CYCGRG 1 cut(s) 107
BsiSI CCGG 1 cut(s) 32
BsoBI CYCGRG 1 cut(s) 107
Bsp143I GATC 3 cut(s) 141, 220, 228
BssMI GATC 3 cut(s) 141, 220, 228
Bst4CI ACNGT 1 cut(s) 160
BstF5I GGATG 2 cut(s) 40, 192
BstKTI GATC 3 cut(s) 144, 223, 231
BstMBI GATC 3 cut(s) 141, 220, 228
BstSFI CTRYAG 1 cut(s) 10
BstX2I RGATCY 1 cut(s) 228
BstYI RGATCY 1 cut(s) 228
BtsCI GGATG 2 cut(s) 40, 192
CviAII CATG 1 cut(s) 145
CviJI RGCY 1 cut(s) 89
CviKI_1 RGCY 1 cut(s) 89
DpnI GATC 3 cut(s) 143, 222, 230
DpnII GATC 3 cut(s) 141, 220, 228
Eco88I CYCGRG 1 cut(s) 107
EcoT22I ATGCAT 1 cut(s) 200
FaeI CATG 1 cut(s) 148
FaiI YATR 5 cut(s) 12, 54, 146, 200, 202
FatI CATG 1 cut(s) 144
FbaI TGATCA 1 cut(s) 141
FokI GGATG 2 cut(s) 47, 199
FspBI CTAG 1 cut(s) 232
HapII CCGG 1 cut(s) 32
Hin1II CATG 1 cut(s) 148
HinfI GANTC 1 cut(s) 38
HpaII CCGG 1 cut(s) 32
HphI GGTGA 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 226
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 4 cut(s) 26, 178, 198, 212
Hsp92II CATG 1 cut(s) 148
Ksp22I TGATCA 1 cut(s) 141
Kzo9I GATC 3 cut(s) 141, 220, 228
LpnPI CCDG 1 cut(s) 45
LweI GCATC 2 cut(s) 93, 177
MaeI CTAG 1 cut(s) 232
MalI GATC 3 cut(s) 143, 222, 230
MboI GATC 3 cut(s) 141, 220, 228
MboII GAAGA 1 cut(s) 136
MflI RGATCY 1 cut(s) 228
MluCI AATT 1 cut(s) 173
MnlI CCTC 2 cut(s) 91, 160
Mph1103I ATGCAT 1 cut(s) 200
MseI TTAA 1 cut(s) 63
MspI CCGG 1 cut(s) 32
NdeII GATC 3 cut(s) 141, 220, 228
NlaIII CATG 1 cut(s) 148
NsiI ATGCAT 1 cut(s) 200
PaeR7I CTCGAG 1 cut(s) 107
PfeI GAWTC 1 cut(s) 38
PspXI VCTCGAGB 1 cut(s) 107
PsuI RGATCY 1 cut(s) 228
SaqAI TTAA 1 cut(s) 63
Sau3AI GATC 3 cut(s) 141, 220, 228
SetI ASST 2 cut(s) 102, 220
SfaNI GCATC 2 cut(s) 93, 177
SfcI CTRYAG 1 cut(s) 10
Sfr274I CTCGAG 1 cut(s) 107
SlaI CTCGAG 1 cut(s) 107
SmlI CTYRAG 2 cut(s) 107, 224
SmoI CTYRAG 2 cut(s) 107, 224
Sse9I AATT 1 cut(s) 173
SspMI CTAG 1 cut(s) 232
TaaI ACNGT 1 cut(s) 160
TaqI TCGA 1 cut(s) 108
TasI AATT 1 cut(s) 173
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
XhoI CTCGAG 1 cut(s) 107
XspI CTAG 1 cut(s) 232
Zsp2I ATGCAT 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.