Rh3BG245300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
23246508 .. 23249635
3128 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG245300.1

Sequence Viewer

Length: 216 bp
ATGCTCGAGCGAGTAGCAGAGAAGATGGAAAAAGACTTGATCATGGTTGAAAAAAGGGCTGATGCTGCTGCTTCCAAGAATACTTCGACCATGACAAAGTCCTGTTCATCATCTCAACCCAATCGTGGATCACAGATCTCTAAAGAGCTGGGTTTGAAATATGAAAATCTAAATCCGAAGATGAACCTAAACATCGTCCCTTCATCATTTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.92

Weight (kDa)

9.25

Isoelectric Point (pI)

48.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 136
AfiI CCNNNNNNNGG 1 cut(s) 125
AgsI TTSAA 2 cut(s) 50, 157
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
AlwI GGATC 1 cut(s) 136
Ama87I CYCGRG 1 cut(s) 5
ApeKI GCWGC 2 cut(s) 65, 68
AvaI CYCGRG 1 cut(s) 5
BbvI GCAGC 2 cut(s) 52, 55
BccI CCATC 1 cut(s) 19
BclI TGATCA 1 cut(s) 39
BglII AGATCT 1 cut(s) 135
BisI GCNGC 2 cut(s) 66, 69
BlsI GCNGC 2 cut(s) 67, 70
BmeT110I CYCGRG 1 cut(s) 5
BmsI GCATC 1 cut(s) 52
Bsc4I CCNNNNNNNGG 1 cut(s) 125
BseLI CCNNNNNNNGG 1 cut(s) 125
BseXI GCAGC 2 cut(s) 52, 55
BseYI CCCAGC 1 cut(s) 148
BsiHKCI CYCGRG 1 cut(s) 5
BslFI GGGAC 1 cut(s) 182
BslI CCNNNNNNNGG 1 cut(s) 125
BsmFI GGGAC 1 cut(s) 182
BsoBI CYCGRG 1 cut(s) 5
Bsp143I GATC 3 cut(s) 39, 128, 135
BspPI GGATC 1 cut(s) 136
BssMI GATC 3 cut(s) 39, 128, 135
BstKTI GATC 3 cut(s) 42, 131, 138
BstMBI GATC 3 cut(s) 39, 128, 135
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstV1I GCAGC 2 cut(s) 52, 55
BstX2I RGATCY 1 cut(s) 135
BstYI RGATCY 1 cut(s) 135
CviAII CATG 2 cut(s) 43, 91
CviJI RGCY 2 cut(s) 59, 148
CviKI_1 RGCY 2 cut(s) 59, 148
DpnI GATC 3 cut(s) 41, 130, 137
DpnII GATC 3 cut(s) 39, 128, 135
Eco88I CYCGRG 1 cut(s) 5
FaeI CATG 2 cut(s) 46, 94
FaiI YATR 3 cut(s) 44, 92, 162
FaqI GGGAC 1 cut(s) 182
FatI CATG 2 cut(s) 42, 90
FbaI TGATCA 1 cut(s) 39
Fnu4HI GCNGC 2 cut(s) 66, 69
Fsp4HI GCNGC 2 cut(s) 66, 69
GluI GCNGC 2 cut(s) 66, 69
GsaI CCCAGC 1 cut(s) 152
Hin1II CATG 2 cut(s) 46, 94
Hpy188I TCNGA 1 cut(s) 177
HpyAV CCTTC 1 cut(s) 210
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
Hsp92II CATG 2 cut(s) 46, 94
Ksp22I TGATCA 1 cut(s) 39
Kzo9I GATC 3 cut(s) 39, 128, 135
LpnPI CCDG 2 cut(s) 115, 134
Lsp1109I GCAGC 2 cut(s) 52, 55
LweI GCATC 1 cut(s) 52
MalI GATC 3 cut(s) 41, 130, 137
MboI GATC 3 cut(s) 39, 128, 135
MboII GAAGA 2 cut(s) 34, 190
MflI RGATCY 1 cut(s) 135
MseI TTAA 1 cut(s) 214
MwoI GCNNNNNNNGC 1 cut(s) 65
NdeII GATC 3 cut(s) 39, 128, 135
NlaIII CATG 2 cut(s) 46, 94
PaeR7I CTCGAG 1 cut(s) 5
PflFI GACNNNGTC 1 cut(s) 97
PkrI GCNGC 2 cut(s) 67, 70
PspFI CCCAGC 1 cut(s) 148
PspXI VCTCGAGB 1 cut(s) 5
PsuI RGATCY 1 cut(s) 135
PsyI GACNNNGTC 1 cut(s) 97
SaqAI TTAA 1 cut(s) 214
SatI GCNGC 2 cut(s) 66, 69
Sau3AI GATC 3 cut(s) 39, 128, 135
SetI ASST 2 cut(s) 150, 189
SfaNI GCATC 1 cut(s) 52
Sfr274I CTCGAG 1 cut(s) 5
SlaI CTCGAG 1 cut(s) 5
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
TaqI TCGA 2 cut(s) 6, 86
Tru1I TTAA 1 cut(s) 214
Tru9I TTAA 1 cut(s) 214
TseI GCWGC 2 cut(s) 65, 68
TspDTI ATGAA 5 cut(s) 96, 177, 192, 197, 200
Tth111I GACNNNGTC 1 cut(s) 97
XhoI CTCGAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.