Rmu_sc0021156.1_g000003

Formiminotransferase domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021156.1
Physical Location & Seq
Forward (+)
5650 .. 5922
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021156.1_g000003.1.cds

Sequence Viewer

Length: 273 bp
ctgaaaaagaggacgctaagcaactgggcctcaaagtgggcttcgaggtcgggtgagaagcctgggttttacaagggctacctcgacctatggaactctgcaatatgggtcgacccgacccagttatcgacccgggtccaaaagggagtgaagaaaattgaggagttggtggagaggtacctagttatggaactcgagaataagagtgtgcaggagataatggaggatttgaggttgaagtttaaggcggtttgtgcttctttgggtgtgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.42

Weight (kDa)

9.48

Isoelectric Point (pI)

29.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 177
AccB1I GGYRCC 1 cut(s) 177
AccI GTMKAC 1 cut(s) 111
AciI CCGC 1 cut(s) 248
AfaI GTAC 1 cut(s) 179
AfiI CCNNNNNNNGG 2 cut(s) 36, 187
AgsI TTSAA 1 cut(s) 238
AjnI CCWGG 1 cut(s) 61
Ama87I CYCGRG 2 cut(s) 132, 194
AoxI GGCC 1 cut(s) 27
Asp718I GGTACC 1 cut(s) 177
AspS9I GGNCC 2 cut(s) 27, 136
AsuC2I CCSGG 2 cut(s) 133, 134
AsuHPI GGTGA 1 cut(s) 65
AvaI CYCGRG 2 cut(s) 132, 194
AvaII GGWCC 1 cut(s) 136
BanI GGYRCC 1 cut(s) 177
BciT130I CCWGG 1 cut(s) 63
BcnI CCSGG 2 cut(s) 133, 134
BfaI CTAG 1 cut(s) 182
BlpI GCTNAGC 1 cut(s) 17
Bme1390I CCNGG 3 cut(s) 63, 133, 134
Bme18I GGWCC 1 cut(s) 136
BmeT110I CYCGRG 2 cut(s) 132, 194
BmgT120I GGNCC 2 cut(s) 27, 136
BmiI GGNNCC 2 cut(s) 137, 179
BmrFI CCNGG 3 cut(s) 63, 133, 134
BmrI ACTGGG 2 cut(s) 34, 115
BmuI ACTGGG 2 cut(s) 34, 115
BoxI GACNNNNGTC 1 cut(s) 134
Bpu1102I GCTNAGC 1 cut(s) 17
BpuMI CCSGG 2 cut(s) 133, 134
BsaJI CCNNGG 2 cut(s) 62, 132
Bsc4I CCNNNNNNNGG 2 cut(s) 36, 187
Bse1I ACTGG 2 cut(s) 29, 121
BseBI CCWGG 1 cut(s) 63
BseDI CCNNGG 2 cut(s) 62, 132
BseLI CCNNNNNNNGG 2 cut(s) 36, 187
BseNI ACTGG 2 cut(s) 29, 121
BseRI GAGGAG 1 cut(s) 176
BsgI GTGCAG 1 cut(s) 230
BshFI GGCC 1 cut(s) 29
BshNI GGYRCC 1 cut(s) 177
BsiHKCI CYCGRG 2 cut(s) 132, 194
BsiSI CCGG 1 cut(s) 133
BslI CCNNNNNNNGG 2 cut(s) 36, 187
BsnI GGCC 1 cut(s) 29
BsoBI CYCGRG 2 cut(s) 132, 194
Bsp1720I GCTNAGC 1 cut(s) 17
BspACI CCGC 1 cut(s) 248
BspANI GGCC 1 cut(s) 29
BspLI GGNNCC 2 cut(s) 137, 179
BspT107I GGYRCC 1 cut(s) 177
BsrI ACTGG 2 cut(s) 29, 121
BssECI CCNNGG 2 cut(s) 62, 132
Bst2UI CCWGG 1 cut(s) 63
BstDEI CTNAG 1 cut(s) 17
BstMWI GCNNNNNNNGC 1 cut(s) 254
BstNI CCWGG 1 cut(s) 63
BstPAI GACNNNNGTC 1 cut(s) 134
BstSCI CCNGG 3 cut(s) 61, 131, 132
BsuRI GGCC 1 cut(s) 29
Cfr13I GGNCC 2 cut(s) 27, 136
Cfr9I CCCGGG 1 cut(s) 132
CseI GACGC 1 cut(s) 22
Csp6I GTAC 1 cut(s) 178
CviJI RGCY 4 cut(s) 29, 41, 61, 78
CviKI_1 RGCY 4 cut(s) 29, 41, 61, 78
CviQI GTAC 1 cut(s) 178
DdeI CTNAG 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 136
Eco88I CYCGRG 2 cut(s) 132, 194
EcoRII CCWGG 1 cut(s) 61
FaiI YATR 3 cut(s) 91, 106, 188
FblI GTMKAC 1 cut(s) 111
FspBI CTAG 1 cut(s) 182
HaeIII GGCC 1 cut(s) 29
HapII CCGG 1 cut(s) 133
HgaI GACGC 1 cut(s) 22
HincII GTYRAC 1 cut(s) 112
HindII GTYRAC 1 cut(s) 112
HpaII CCGG 1 cut(s) 133
HphI GGTGA 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 196
Hpy8I GTNNAC 1 cut(s) 112
HpyCH4V TGCA 2 cut(s) 101, 211
HpyF10VI GCNNNNNNNGC 1 cut(s) 254
HpyF3I CTNAG 1 cut(s) 17
KpnI GGTACC 1 cut(s) 181
LpnPI CCDG 6 cut(s) 10, 48, 75, 134, 146, 197
MaeI CTAG 1 cut(s) 182
MboII GAAGA 1 cut(s) 163
MluCI AATT 1 cut(s) 156
MnlI CCTC 8 cut(s) 3, 39, 40, 92, 154, 168, 217, 225
MseI TTAA 1 cut(s) 243
MspI CCGG 1 cut(s) 133
MspR9I CCNGG 3 cut(s) 63, 133, 134
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 254
NciI CCSGG 2 cut(s) 133, 134
NlaIV GGNNCC 2 cut(s) 137, 179
PaeR7I CTCGAG 1 cut(s) 194
PshAI GACNNNNGTC 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
PspN4I GGNNCC 2 cut(s) 137, 179
PspPI GGNCC 2 cut(s) 27, 136
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
SalI GTCGAC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 243
Sau96I GGNCC 2 cut(s) 27, 136
ScrFI CCNGG 3 cut(s) 63, 133, 134
SetI ASST 6 cut(s) 50, 84, 90, 179, 183, 236
Sfr274I CTCGAG 1 cut(s) 194
SinI GGWCC 1 cut(s) 136
SlaI CTCGAG 1 cut(s) 194
SmaI CCCGGG 1 cut(s) 134
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
Sse9I AATT 1 cut(s) 156
SsiI CCGC 1 cut(s) 248
SspMI CTAG 1 cut(s) 182
StyD4I CCNGG 3 cut(s) 61, 131, 132
TaqI TCGA 5 cut(s) 44, 84, 111, 128, 195
TasI AATT 1 cut(s) 156
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TspMI CCCGGG 1 cut(s) 132
VpaK11BI GGWCC 1 cut(s) 136
XhoI CTCGAG 1 cut(s) 194
XmaI CCCGGG 1 cut(s) 132
XmiI GTMKAC 1 cut(s) 111
XspI CTAG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.