Rmu_sc0034546.1_g000001

glycerol-3-phosphate transporter

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0034546.1
Physical Location & Seq
Forward (+)
1 .. 434
434 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0034546.1_g000001.1.cds

Sequence Viewer

Length: 388 bp
gctcggagaacttgatcttgcatttctgtctgcattttctattgggatgtattttgcagggcatgtcggtgatgggattgatttgaggttgtttcttgcttatgggatgttggggagtggagttttgactcgtcttttcgggttaggttattggtgcaatgtgcatatgttgtggtattttgtgggtgtgcaagttgtgtgtgggttgtttcagtcgataggttggccttgtgttgtggcagttgtggggaattggtttgggaagacgaagcgggggttgataatgggggtgtggagttcacatacctcggttgggaacattgttggatcggttattgcttccggggttttgtgccactttgtttttgatacgcattgccagaactga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

13.87

Weight (kDa)

7.1

Isoelectric Point (pI)

14.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 272
AclWI GGATC 1 cut(s) 335
AfiI CCNNNNNNNGG 1 cut(s) 313
AlwI GGATC 1 cut(s) 335
AoxI GGCC 1 cut(s) 225
AsuC2I CCSGG 1 cut(s) 344
AsuHPI GGTGA 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 270
BccI CCATC 1 cut(s) 66
BcnI CCSGG 1 cut(s) 344
Bme1390I CCNGG 1 cut(s) 344
BmrFI CCNGG 1 cut(s) 344
BpiI GAAGAC 1 cut(s) 270
BpuMI CCSGG 1 cut(s) 344
BsaJI CCNNGG 2 cut(s) 307, 343
Bsc4I CCNNNNNNNGG 1 cut(s) 313
Bse3DI GCAATG 2 cut(s) 164, 374
BseDI CCNNGG 2 cut(s) 307, 343
BseGI GGATG 2 cut(s) 52, 112
BseLI CCNNNNNNNGG 1 cut(s) 313
BseMI GCAATG 2 cut(s) 164, 374
BshFI GGCC 1 cut(s) 227
BsiSI CCGG 1 cut(s) 343
BslI CCNNNNNNNGG 1 cut(s) 313
BsnI GGCC 1 cut(s) 227
Bsp143I GATC 2 cut(s) 14, 327
BspACI CCGC 1 cut(s) 272
BspANI GGCC 1 cut(s) 227
BspPI GGATC 1 cut(s) 335
BsrDI GCAATG 2 cut(s) 164, 374
BssECI CCNNGG 2 cut(s) 307, 343
BssMI GATC 2 cut(s) 14, 327
BstF5I GGATG 2 cut(s) 52, 112
BstKTI GATC 2 cut(s) 17, 330
BstMBI GATC 2 cut(s) 14, 327
BstNSI RCATGY 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 342
BstV2I GAAGAC 1 cut(s) 270
BsuRI GGCC 1 cut(s) 227
BtsCI GGATG 2 cut(s) 52, 112
CviAII CATG 1 cut(s) 63
CviJI RGCY 1 cut(s) 227
CviKI_1 RGCY 1 cut(s) 227
DpnI GATC 2 cut(s) 16, 329
DpnII GATC 2 cut(s) 14, 327
FaeI CATG 1 cut(s) 66
FaiI YATR 5 cut(s) 64, 103, 166, 168, 304
FatI CATG 1 cut(s) 62
FauI CCCGC 1 cut(s) 265
FauNDI CATATG 1 cut(s) 166
FokI GGATG 2 cut(s) 59, 119
HaeIII GGCC 1 cut(s) 227
HapII CCGG 1 cut(s) 343
Hin1II CATG 1 cut(s) 66
HinfI GANTC 1 cut(s) 128
HpaII CCGG 1 cut(s) 343
HphI GGTGA 1 cut(s) 81
Hpy166II GTNNAC 1 cut(s) 300
Hpy188I TCNGA 1 cut(s) 6
Hpy8I GTNNAC 1 cut(s) 300
HpyCH4V TGCA 6 cut(s) 21, 33, 57, 157, 164, 191
Hsp92II CATG 1 cut(s) 66
Kzo9I GATC 2 cut(s) 14, 327
LpnPI CCDG 2 cut(s) 43, 356
MalI GATC 2 cut(s) 16, 329
MboI GATC 2 cut(s) 14, 327
MboII GAAGA 1 cut(s) 275
MluCI AATT 1 cut(s) 251
MlyI GAGTC 1 cut(s) 122
MmeI TCCRAC 1 cut(s) 305
MnlI CCTC 2 cut(s) 79, 317
MslI CAYNNNNRTG 1 cut(s) 67
MspI CCGG 1 cut(s) 343
MspR9I CCNGG 1 cut(s) 344
NciI CCSGG 1 cut(s) 344
NdeI CATATG 1 cut(s) 166
NdeII GATC 2 cut(s) 14, 327
NlaIII CATG 1 cut(s) 66
NspI RCATGY 1 cut(s) 66
PleI GAGTC 1 cut(s) 122
PpsI GAGTC 1 cut(s) 122
RseI CAYNNNNRTG 1 cut(s) 67
Sau3AI GATC 2 cut(s) 14, 327
SchI GAGTC 1 cut(s) 122
ScrFI CCNGG 1 cut(s) 344
SetI ASST 4 cut(s) 90, 149, 224, 309
SmiMI CAYNNNNRTG 1 cut(s) 67
Sse9I AATT 1 cut(s) 251
SsiI CCGC 1 cut(s) 272
StyD4I CCNGG 1 cut(s) 342
TaqI TCGA 1 cut(s) 216
TasI AATT 1 cut(s) 251
XceI RCATGY 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.