Rh3AG088200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
7109446 .. 7111890
2445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG088200.1

Sequence Viewer

Length: 231 bp
ATGCTTGATTTTCAAAGTCCCAGCAAATCGCTTCATGATCAATGCGAACCGGCAAATGCTAAAATCAAATTTGAAGATAACTATTTTGTTGATGCGTTTTCTCAGGTTTATCATGCTCATGTTGTCAATGACAATTTGTACAAGAAGCCATGTTGTTGCAGGACTTGCATTGATCTCTACAACGAAAGATCCCGTGAAGGAATGAAAATTAGAGCACCACATGTTGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.82

Weight (kDa)

6.88

Isoelectric Point (pI)

33.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 224
AclWI GGATC 1 cut(s) 183
AcsI RAATTY 1 cut(s) 68
AfaI GTAC 1 cut(s) 140
AfiI CCNNNNNNNGG 1 cut(s) 224
AflIII ACRYGT 1 cut(s) 220
AgsI TTSAA 2 cut(s) 14, 74
Alw21I GWGCWC 1 cut(s) 217
AlwI GGATC 1 cut(s) 183
ApoI RAATTY 1 cut(s) 68
Bbv12I GWGCWC 1 cut(s) 217
BclI TGATCA 1 cut(s) 37
BmsI GCATC 1 cut(s) 82
Bsc4I CCNNNNNNNGG 1 cut(s) 224
Bse118I RCCGGY 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 224
BseMII CTCAG 1 cut(s) 116
BseYI CCCAGC 1 cut(s) 20
BsiHKAI GWGCWC 1 cut(s) 217
BsiSI CCGG 1 cut(s) 50
BslFI GGGAC 1 cut(s) 3
BslI CCNNNNNNNGG 1 cut(s) 224
BsmFI GGGAC 1 cut(s) 3
Bsp1286I GDGCHC 1 cut(s) 217
Bsp1407I TGTACA 1 cut(s) 138
Bsp143I GATC 3 cut(s) 37, 172, 188
BspCNI CTCAG 1 cut(s) 115
BspHI TCATGA 1 cut(s) 34
BspPI GGATC 1 cut(s) 183
BsrFI RCCGGY 1 cut(s) 49
BsrGI TGTACA 1 cut(s) 138
BssAI RCCGGY 1 cut(s) 49
BssMI GATC 3 cut(s) 37, 172, 188
BstAPI GCANNNNNTGC 1 cut(s) 165
BstAUI TGTACA 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 102
BstKTI GATC 3 cut(s) 40, 175, 191
BstMBI GATC 3 cut(s) 37, 172, 188
BstMWI GCNNNNNNNGC 1 cut(s) 165
BstNSI RCATGY 1 cut(s) 224
BstX2I RGATCY 1 cut(s) 188
BstYI RGATCY 1 cut(s) 188
CciI TCATGA 1 cut(s) 34
Cfr10I RCCGGY 1 cut(s) 49
Csp6I GTAC 1 cut(s) 139
CviAII CATG 5 cut(s) 35, 113, 119, 150, 221
CviJI RGCY 1 cut(s) 148
CviKI_1 RGCY 1 cut(s) 148
CviQI GTAC 1 cut(s) 139
DdeI CTNAG 1 cut(s) 102
DpnI GATC 3 cut(s) 39, 174, 190
DpnII GATC 3 cut(s) 37, 172, 188
FaeI CATG 5 cut(s) 38, 116, 122, 153, 224
FaiI YATR 5 cut(s) 36, 114, 120, 151, 222
FaqI GGGAC 1 cut(s) 3
FatI CATG 5 cut(s) 34, 112, 118, 149, 220
FbaI TGATCA 1 cut(s) 37
GsaI CCCAGC 1 cut(s) 24
HapII CCGG 1 cut(s) 50
Hin1II CATG 5 cut(s) 38, 116, 122, 153, 224
HpaII CCGG 1 cut(s) 50
Hpy188III TCNNGA 1 cut(s) 35
HpyAV CCTTC 1 cut(s) 191
HpyCH4V TGCA 2 cut(s) 159, 168
HpyF10VI GCNNNNNNNGC 1 cut(s) 165
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 5 cut(s) 38, 116, 122, 153, 224
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 3 cut(s) 37, 172, 188
LpnPI CCDG 4 cut(s) 34, 63, 89, 145
LweI GCATC 1 cut(s) 82
MalI GATC 3 cut(s) 39, 174, 190
MboI GATC 3 cut(s) 37, 172, 188
MboII GAAGA 1 cut(s) 86
MflI RGATCY 1 cut(s) 188
MhlI GDGCHC 1 cut(s) 217
MluCI AATT 3 cut(s) 68, 133, 207
MslI CAYNNNNRTG 1 cut(s) 117
MspI CCGG 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 165
NdeII GATC 3 cut(s) 37, 172, 188
NlaIII CATG 5 cut(s) 38, 116, 122, 153, 224
NspI RCATGY 1 cut(s) 224
PagI TCATGA 1 cut(s) 34
PciI ACATGT 1 cut(s) 220
PflMI CCANNNNNTGG 1 cut(s) 224
PscI ACATGT 1 cut(s) 220
PspFI CCCAGC 1 cut(s) 20
PsuI RGATCY 1 cut(s) 188
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
RseI CAYNNNNRTG 1 cut(s) 117
Sau3AI GATC 3 cut(s) 37, 172, 188
SduI GDGCHC 1 cut(s) 217
SetI ASST 1 cut(s) 108
SfaNI GCATC 1 cut(s) 82
SmiMI CAYNNNNRTG 1 cut(s) 117
Sse9I AATT 3 cut(s) 68, 133, 207
TasI AATT 3 cut(s) 68, 133, 207
TatI WGTACW 1 cut(s) 138
TspDTI ATGAA 2 cut(s) 23, 218
Van91I CCANNNNNTGG 1 cut(s) 224
XapI RAATTY 1 cut(s) 68
XceI RCATGY 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.