Rmu_ssc0000372.1_g000072

Transcription factor IIIB

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000372.1
Physical Location & Seq
Reverse (-)
270018 .. 271157
1140 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000372.1_g000072.1.cds

Sequence Viewer

Length: 387 bp
atgattctcggattgagttttggtctctcccatatggagactagcgcacatatacgcaaacaagcaactgtcaaaatcgggatgaaatcagctgtttctaatacactatctctattttatcttcaatcaatgaatgcatggaaacagaacgaggataatgaggctcctgatgtctcccagaaaagaaaatttgattcacatcttgacaatgacaacaagatgccccatgacagtgaagagcttgaatttgatgcatacaaagatgatgacttggatatggaacatgaatatggggatgaagaaggaattgaaggaacaggcttcaacaattacggttatgttgatgaagtagacgagtacaatgatcgtgattatgatgatttctga

Protein Analysis

128

Amino Acids

14.8

Weight (kDa)

4.25

Isoelectric Point (pI)

47.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 351
AcsI RAATTY 2 cut(s) 188, 245
AfaI GTAC 1 cut(s) 359
AgsI TTSAA 4 cut(s) 125, 245, 311, 325
AluBI AGCT 2 cut(s) 92, 241
AluI AGCT 2 cut(s) 92, 241
Alw26I GTCTC 3 cut(s) 29, 32, 178
ApoI RAATTY 2 cut(s) 188, 245
AspLEI GCGC 1 cut(s) 47
BcoDI GTCTC 3 cut(s) 29, 32, 178
BfaI CTAG 1 cut(s) 42
BmiI GGNNCC 1 cut(s) 165
BmsI GCATC 2 cut(s) 210, 241
BsaBI GATNNNNATC 1 cut(s) 198
BsaI GGTCTC 1 cut(s) 29
Bse8I GATNNNNATC 1 cut(s) 198
BseGI GGATG 2 cut(s) 87, 301
BseJI GATNNNNATC 1 cut(s) 198
BsmAI GTCTC 3 cut(s) 29, 32, 178
BsmI GAATGC 1 cut(s) 139
Bso31I GGTCTC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 364
BspLI GGNNCC 1 cut(s) 165
BspQI GCTCTTC 1 cut(s) 231
BspTNI GGTCTC 1 cut(s) 29
BssMI GATC 1 cut(s) 364
Bst4CI ACNGT 3 cut(s) 70, 233, 335
Bst6I CTCTTC 1 cut(s) 231
BstF5I GGATG 2 cut(s) 87, 301
BstHHI GCGC 1 cut(s) 47
BstKTI GATC 1 cut(s) 367
BstMAI GTCTC 3 cut(s) 29, 32, 178
BstMBI GATC 1 cut(s) 364
BtsCI GGATG 2 cut(s) 87, 301
BtsIMutI CAGTG 1 cut(s) 238
CfoI GCGC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 358
CviAII CATG 3 cut(s) 138, 227, 284
CviJI RGCY 4 cut(s) 92, 164, 241, 321
CviKI_1 RGCY 4 cut(s) 92, 164, 241, 321
CviQI GTAC 1 cut(s) 358
DpnI GATC 1 cut(s) 366
DpnII GATC 1 cut(s) 364
Eam1104I CTCTTC 1 cut(s) 231
EarI CTCTTC 1 cut(s) 231
Eco31I GGTCTC 1 cut(s) 29
EcoT22I ATGCAT 2 cut(s) 139, 256
FaeI CATG 3 cut(s) 141, 230, 287
FatI CATG 3 cut(s) 137, 226, 283
FauNDI CATATG 1 cut(s) 33
FblI GTMKAC 1 cut(s) 351
FokI GGATG 2 cut(s) 94, 308
FspBI CTAG 1 cut(s) 42
GlaI GCGC 1 cut(s) 46
HhaI GCGC 1 cut(s) 47
Hin1II CATG 3 cut(s) 141, 230, 287
Hin6I GCGC 1 cut(s) 45
HinP1I GCGC 1 cut(s) 45
HinfI GANTC 2 cut(s) 4, 194
Hpy166II GTNNAC 1 cut(s) 352
Hpy188I TCNGA 2 cut(s) 11, 386
Hpy188III TCNNGA 4 cut(s) 79, 167, 203, 368
Hpy8I GTNNAC 1 cut(s) 352
HpyAV CCTTC 2 cut(s) 296, 305
HpyCH4III ACNGT 3 cut(s) 70, 233, 335
HpyCH4V TGCA 2 cut(s) 137, 254
Hsp92II CATG 3 cut(s) 141, 230, 287
HspAI GCGC 1 cut(s) 45
Kzo9I GATC 1 cut(s) 364
LguI GCTCTTC 1 cut(s) 231
LmnI GCTCC 1 cut(s) 169
LpnPI CCDG 3 cut(s) 180, 191, 303
LweI GCATC 2 cut(s) 210, 241
MaeI CTAG 1 cut(s) 42
MalI GATC 1 cut(s) 366
MboI GATC 1 cut(s) 364
MboII GAAGA 3 cut(s) 113, 248, 311
MluCI AATT 4 cut(s) 188, 245, 306, 328
MnlI CCTC 2 cut(s) 145, 154
Mph1103I ATGCAT 2 cut(s) 139, 256
MslI CAYNNNNRTG 2 cut(s) 231, 288
MspA1I CMGCKG 1 cut(s) 92
Mva1269I GAATGC 1 cut(s) 139
NdeI CATATG 1 cut(s) 33
NdeII GATC 1 cut(s) 364
NlaIII CATG 3 cut(s) 141, 230, 287
NlaIV GGNNCC 1 cut(s) 165
NsiI ATGCAT 2 cut(s) 139, 256
PciSI GCTCTTC 1 cut(s) 231
PctI GAATGC 1 cut(s) 139
PfeI GAWTC 2 cut(s) 4, 194
PspN4I GGNNCC 1 cut(s) 165
PvuII CAGCTG 1 cut(s) 92
RsaI GTAC 1 cut(s) 359
RsaNI GTAC 1 cut(s) 358
RseI CAYNNNNRTG 2 cut(s) 231, 288
SapI GCTCTTC 1 cut(s) 231
Sau3AI GATC 1 cut(s) 364
SetI ASST 2 cut(s) 94, 243
SfaNI GCATC 2 cut(s) 210, 241
SmiMI CAYNNNNRTG 2 cut(s) 231, 288
Sse9I AATT 4 cut(s) 188, 245, 306, 328
SspMI CTAG 1 cut(s) 42
TaaI ACNGT 3 cut(s) 70, 233, 335
TasI AATT 4 cut(s) 188, 245, 306, 328
TatI WGTACW 1 cut(s) 357
TfiI GAWTC 2 cut(s) 4, 194
TscAI CASTG 1 cut(s) 238
TspDTI ATGAA 5 cut(s) 98, 146, 300, 312, 360
TspRI CASTG 1 cut(s) 238
XapI RAATTY 2 cut(s) 188, 245
XmiI GTMKAC 1 cut(s) 351
XspI CTAG 1 cut(s) 42
Zsp2I ATGCAT 2 cut(s) 139, 256
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.