Rh4CG264400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0000772
Physical Location & Seq
Reverse (-)
51886240 .. 51887157
918 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG264400.1

Sequence Viewer

Length: 204 bp
ATGGCACCGGATCGTTCGCGGCGAGGCTGGTGGAGGAATGAGCGATCTGCAGCTCTGATGGTCTTGGCTTGGAAGATTGGTGGTTGGGCCGAGCTTGGCGGGAGGGATCTTGGTAATTCGCCGGAGGTTCTTCTAGGCAATTCTATGGATTCCGATGTTAAGGAAGATTATCAACAAATTAATTACTTAGTGAAGTGTATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.62

Weight (kDa)

6.14

Isoelectric Point (pI)

55.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AccII CGCG 1 cut(s) 19
AciI CCGC 2 cut(s) 19, 99
AclWI GGATC 2 cut(s) 18, 114
AluBI AGCT 2 cut(s) 53, 94
AluI AGCT 2 cut(s) 53, 94
AlwI GGATC 2 cut(s) 18, 114
AoxI GGCC 1 cut(s) 87
ApeKI GCWGC 1 cut(s) 50
AseI ATTAAT 1 cut(s) 180
AspS9I GGNCC 1 cut(s) 87
BanI GGYRCC 1 cut(s) 4
BbvI GCAGC 1 cut(s) 62
BccI CCATC 1 cut(s) 52
BfaI CTAG 1 cut(s) 134
BfmI CTRYAG 1 cut(s) 48
BisI GCNGC 2 cut(s) 20, 51
BlsI GCNGC 2 cut(s) 21, 52
BmgT120I GGNCC 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 6
BsaWI WCCGGW 1 cut(s) 7
BseXI GCAGC 1 cut(s) 62
Bsh1236I CGCG 1 cut(s) 19
BshFI GGCC 1 cut(s) 89
BshNI GGYRCC 1 cut(s) 4
BsiSI CCGG 2 cut(s) 8, 122
BsnI GGCC 1 cut(s) 89
Bsp143I GATC 3 cut(s) 10, 44, 106
BspACI CCGC 2 cut(s) 19, 99
BspANI GGCC 1 cut(s) 89
BspFNI CGCG 1 cut(s) 19
BspLI GGNNCC 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 52
BspPI GGATC 2 cut(s) 18, 114
BspT107I GGYRCC 1 cut(s) 4
BssMI GATC 3 cut(s) 10, 44, 106
BstDEI CTNAG 1 cut(s) 187
BstFNI CGCG 1 cut(s) 19
BstKTI GATC 3 cut(s) 13, 47, 109
BstMBI GATC 3 cut(s) 10, 44, 106
BstSFI CTRYAG 1 cut(s) 48
BstUI CGCG 1 cut(s) 19
BstV1I GCAGC 1 cut(s) 62
BstX2I RGATCY 1 cut(s) 106
BstYI RGATCY 1 cut(s) 106
BsuRI GGCC 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 87
CviJI RGCY 5 cut(s) 27, 53, 68, 89, 94
CviKI_1 RGCY 5 cut(s) 27, 53, 68, 89, 94
DdeI CTNAG 1 cut(s) 187
DpnI GATC 3 cut(s) 12, 46, 108
DpnII GATC 3 cut(s) 10, 44, 106
FaiI YATR 1 cut(s) 146
FauI CCCGC 1 cut(s) 92
Fnu4HI GCNGC 2 cut(s) 20, 51
Fsp4HI GCNGC 2 cut(s) 20, 51
FspBI CTAG 1 cut(s) 134
GluI GCNGC 2 cut(s) 20, 51
HaeIII GGCC 1 cut(s) 89
HapII CCGG 2 cut(s) 8, 122
HinfI GANTC 1 cut(s) 149
HpaII CCGG 2 cut(s) 8, 122
Hpy188I TCNGA 2 cut(s) 57, 154
HpyCH4V TGCA 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 187
Kzo9I GATC 3 cut(s) 10, 44, 106
LpnPI CCDG 3 cut(s) 13, 21, 135
Lsp1109I GCAGC 1 cut(s) 62
MaeI CTAG 1 cut(s) 134
MalI GATC 3 cut(s) 12, 46, 108
MboI GATC 3 cut(s) 10, 44, 106
MboII GAAGA 3 cut(s) 85, 122, 176
MflI RGATCY 1 cut(s) 106
MluCI AATT 4 cut(s) 115, 139, 177, 181
MnlI CCTC 4 cut(s) 17, 27, 96, 118
MseI TTAA 3 cut(s) 159, 180, 202
MspI CCGG 2 cut(s) 8, 122
MvnI CGCG 1 cut(s) 19
NdeII GATC 3 cut(s) 10, 44, 106
NlaIV GGNNCC 1 cut(s) 6
NmeAIII GCCGAG 1 cut(s) 115
PcsI WCGNNNNNNNCGW 1 cut(s) 19
PfeI GAWTC 1 cut(s) 149
PkrI GCNGC 2 cut(s) 21, 52
PshBI ATTAAT 1 cut(s) 180
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 87
PstI CTGCAG 1 cut(s) 52
PsuI RGATCY 1 cut(s) 106
SaqAI TTAA 3 cut(s) 159, 180, 202
SatI GCNGC 2 cut(s) 20, 51
Sau3AI GATC 3 cut(s) 10, 44, 106
Sau96I GGNCC 1 cut(s) 87
SetI ASST 3 cut(s) 55, 96, 129
SfcI CTRYAG 1 cut(s) 48
Sse9I AATT 4 cut(s) 115, 139, 177, 181
SsiI CCGC 2 cut(s) 19, 99
SspMI CTAG 1 cut(s) 134
TasI AATT 4 cut(s) 115, 139, 177, 181
TauI GCSGC 1 cut(s) 22
TfiI GAWTC 1 cut(s) 149
Tru1I TTAA 3 cut(s) 159, 180, 202
Tru9I TTAA 3 cut(s) 159, 180, 202
TseI GCWGC 1 cut(s) 50
VspI ATTAAT 1 cut(s) 180
XspI CTAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.