Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000472.1

Orthogroup ID

OG0002977

Physical Location & Seq

Genomic Coordinates Forward (+)

55620 .. 57603

Gene Structure 1984 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000472.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 969 bp

atgggttctatatggactacctatcaagagagcactgatgatttgaacaagaagcttctttacactacccttgagcttgaaacaatgaagaatttagcaacagagagtcaagagaatgtgaagaatctactcaatctactaaaggttgcatacaaagaaagagatgaagccagagaccagctgcacaagttcttcaacaagatcactgcttctactccaattgacttacccaatgtgcagtttaatcaagtagtccagcccgaaagtccgactttgatgcccacaaaagcaaactcaagcattactgaatccaacagcctctctgaaacttacaatccccaatcacatatctcttctcctgttgattcattgtttgatgcagtctcttcccctgagtttaccaatatcaacatggctgattctagcaacaacatgggttttgtgaagcagcctttggtgaaagaatttaatggaagtactattatacctactggtgtagtagtctcttctggttcaagtatcaaagctgatcctgctgatgaaataattgacaattttgttaggggtaggcctttgcctcagaaaggaatgttattgcaagctgtgatggatgctggtccattgcttcagacacttctcgttgcaggtcctatgccccggtggcgaaatccccctcctttgcagcccttcaaaatcccaccagtttcaatcaaaggttgtgaagctgctgtgagttttaacaaccagaaaccagtggcaagtcatacctatgtggttcataagacacagaacgcaacatcttatcctgagatgactcgaggcttttctcaaacatgttcagctgccatgttgaatttcaacaatgtcaatcctaatgctgtttcatacctaaacaattcaagaatgccgagttcaatttccagttttgatcaccaaatcccaattgccaagcggcataggcttcaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1635

Protein Analysis

322

Amino Acids

35.58

Weight (kDa)

7.02

Isoelectric Point (pI)

50.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002977)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G28690 AT5G59760
fragaria_vesca	FvH4_3g34910 FvH4_3g34910
malus_domestica	MD03G1100400.v1.1 MD11G1114400.v1.1
prunus_persica	Prupe.6G085300_v2.0.a1
pyrus_communis	pycom03g08250 pycom11g09620
rosa_chinensis	RchiOBHm_Chr1g0380111 RchiOBHm_Chr5g0062781 RchiOBHm_Chr6g0300901
rosa_laevigata	RLG00000011292 RLG00000026330 RLG00000035577
rosa_multiflora	Rmu_sc0001232.1_g000013 Rmu_sc0004576.1_g000006 Rmu_sc0006254.1_g000002 Rmu_ssc0000472.1_g000009
rosa_roxburghii	Rroxscaffold_1G00017840 Rroxscaffold_4G00279670 Rroxscaffold_7G00167330
rosa_rugosa	Rorug01G0417500 Rorug05G0351600
rosa_samantha	Rh1AG442700 Rh1BG397800 Rh1CG411300 Rh1DG428600 Rh5AG412600 Rh5BG426500 Rh5CG450600 Rh5DG440400 Rh6AG412900 Rh6BG420100 Rh6CG427600 Rh6DG412900
rosa_wichuraiana	Rw1G038440 Rw5G038780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	635
AciI	CCGC	1 cut(s)	952
AclWI	GGATC	1 cut(s)	524
AcsI	RAATTY	3 cut(s)	91, 464, 853
AcuI	CTGAAG	1 cut(s)	611
AfaI	GTAC	1 cut(s)	478
AfiI	CCNNNNNNNGG	1 cut(s)	584
AflIII	ACRYGT	1 cut(s)	833
AjuI	GAANNNNNNNTTGG	2 cut(s)	437, 469
AluBI	AGCT	7 cut(s)	55, 76, 181, 527, 602, 725, 842
AluI	AGCT	7 cut(s)	55, 76, 181, 527, 602, 725, 842
Alw21I	GWGCWC	1 cut(s)	35
Alw26I	GTCTC	3 cut(s)	168, 388, 508
AlwI	GGATC	1 cut(s)	524
Ama87I	CYCGRG	1 cut(s)	816
AoxI	GGCC	1 cut(s)	569
ApeKI	GCWGC	5 cut(s)	181, 448, 682, 725, 842
ApoI	RAATTY	3 cut(s)	91, 464, 853
AspS9I	GGNCC	2 cut(s)	617, 647
AsuC2I	CCSGG	1 cut(s)	658
AsuHPI	GGTGA	2 cut(s)	469, 923
AvaI	CYCGRG	1 cut(s)	816
AvaII	GGWCC	2 cut(s)	617, 647
BarI	GAAGNNNNNNTAC	2 cut(s)	44, 76
Bbv12I	GWGCWC	1 cut(s)	35
BbvI	GCAGC	5 cut(s)	168, 460, 694, 712, 829
BccI	CCATC	1 cut(s)	601
BcgI	CGANNNNNNTGC	2 cut(s)	259, 293
BclI	TGATCA	1 cut(s)	928
BcnI	CCSGG	1 cut(s)	658
BcoDI	GTCTC	3 cut(s)	168, 388, 508
BfaI	CTAG	1 cut(s)	423
BfuAI	ACCTGC	1 cut(s)	635
BglI	GCCNNNNNGGC	1 cut(s)	661
BisI	GCNGC	6 cut(s)	182, 449, 683, 726, 843, 953
BlsI	GCNGC	6 cut(s)	183, 450, 684, 727, 844, 954
BmcAI	AGTACT	1 cut(s)	478
Bme1390I	CCNGG	1 cut(s)	658
Bme18I	GGWCC	2 cut(s)	617, 647
BmeT110I	CYCGRG	1 cut(s)	816
BmgT120I	GGNCC	2 cut(s)	617, 647
BmrFI	CCNGG	1 cut(s)	658
BmsI	GCATC	3 cut(s)	267, 367, 601
BpuEI	CTTGAG	2 cut(s)	92, 280
BpuMI	CCSGG	1 cut(s)	658
BsaI	GGTCTC	1 cut(s)	168
BsaJI	CCNNGG	1 cut(s)	656
Bsc4I	CCNNNNNNNGG	1 cut(s)	584
Bse1I	ACTGG	4 cut(s)	496, 701, 752, 921
Bse3DI	GCAATG	1 cut(s)	620
BseDI	CCNNGG	1 cut(s)	656
BseGI	GGATG	1 cut(s)	616
BseLI	CCNNNNNNNGG	1 cut(s)	584
BseMI	GCAATG	1 cut(s)	620
BseMII	CTCAG	3 cut(s)	384, 593, 798
BseNI	ACTGG	4 cut(s)	496, 701, 752, 921
BseXI	GCAGC	5 cut(s)	168, 460, 694, 712, 829
BsgI	GTGCAG	2 cut(s)	167, 257
BshFI	GGCC	1 cut(s)	571
BsiHKAI	GWGCWC	1 cut(s)	35
BsiHKCI	CYCGRG	1 cut(s)	816
BsiSI	CCGG	1 cut(s)	658
BslI	CCNNNNNNNGG	1 cut(s)	584
BsmAI	GTCTC	3 cut(s)	168, 388, 508
BsmI	GAATGC	1 cut(s)	909
BsnI	GGCC	1 cut(s)	571
Bso31I	GGTCTC	1 cut(s)	168
BsoBI	CYCGRG	1 cut(s)	816
Bsp1286I	GDGCHC	1 cut(s)	35
Bsp143I	GATC	3 cut(s)	201, 529, 928
BspACI	CCGC	1 cut(s)	952
BspANI	GGCC	1 cut(s)	571
BspCNI	CTCAG	3 cut(s)	385, 592, 799
BspMI	ACCTGC	1 cut(s)	635
BspPI	GGATC	1 cut(s)	524
BspTNI	GGTCTC	1 cut(s)	168
BsrDI	GCAATG	1 cut(s)	620
BsrI	ACTGG	4 cut(s)	496, 701, 752, 921
BssECI	CCNNGG	1 cut(s)	656
BssMI	GATC	3 cut(s)	201, 529, 928
Bst6I	CTCTTC	3 cut(s)	358, 391, 511
BstC8I	GCNNGC	1 cut(s)	600
BstDEI	CTNAG	3 cut(s)	393, 579, 807
BstENI	CCTNNNNNAGG	1 cut(s)	582
BstF5I	GGATG	1 cut(s)	616
BstKTI	GATC	3 cut(s)	204, 532, 931
BstMAI	GTCTC	3 cut(s)	168, 388, 508
BstMBI	GATC	3 cut(s)	201, 529, 928
BstMWI	GCNNNNNNNGC	3 cut(s)	533, 661, 958
BstNSI	RCATGY	1 cut(s)	837
BstSCI	CCNGG	1 cut(s)	656
BstV1I	GCAGC	5 cut(s)	168, 460, 694, 712, 829
BsuRI	GGCC	1 cut(s)	571
BtsCI	GGATG	1 cut(s)	616
BtsI	GCAGTG	1 cut(s)	204
BtsIMutI	CAGTG	3 cut(s)	33, 204, 759
BveI	ACCTGC	1 cut(s)	635
Cac8I	GCNNGC	1 cut(s)	600
Cfr13I	GGNCC	2 cut(s)	617, 647
Csp6I	GTAC	1 cut(s)	477
CviAII	CATG	4 cut(s)	412, 433, 834, 847
CviQI	GTAC	1 cut(s)	477
DdeI	CTNAG	3 cut(s)	393, 579, 807
DpnI	GATC	3 cut(s)	203, 531, 930
DpnII	GATC	3 cut(s)	201, 529, 928
Eam1104I	CTCTTC	3 cut(s)	358, 391, 511
EarI	CTCTTC	3 cut(s)	358, 391, 511
Eco147I	AGGCCT	1 cut(s)	571
Eco31I	GGTCTC	1 cut(s)	168
Eco47I	GGWCC	2 cut(s)	617, 647
Eco57I	CTGAAG	1 cut(s)	611
Eco88I	CYCGRG	1 cut(s)	816
EcoNI	CCTNNNNNAGG	1 cut(s)	582
EcoO109I	RGGNCCY	1 cut(s)	647
FaeI	CATG	4 cut(s)	415, 436, 837, 850
FalI	AAGNNNNNCTT	2 cut(s)	256, 288
FatI	CATG	4 cut(s)	411, 432, 833, 846
FbaI	TGATCA	1 cut(s)	928
Fnu4HI	GCNGC	6 cut(s)	182, 449, 683, 726, 843, 953
FokI	GGATG	1 cut(s)	623
Fsp4HI	GCNGC	6 cut(s)	182, 449, 683, 726, 843, 953
FspBI	CTAG	1 cut(s)	423
GluI	GCNGC	6 cut(s)	182, 449, 683, 726, 843, 953
HaeIII	GGCC	1 cut(s)	571
HapII	CCGG	1 cut(s)	658
Hin1II	CATG	4 cut(s)	415, 436, 837, 850
HindIII	AAGCTT	1 cut(s)	53
HinfI	GANTC	6 cut(s)	106, 124, 308, 365, 419, 814
HpaII	CCGG	1 cut(s)	658
HphI	GGTGA	2 cut(s)	469, 923
Hpy166II	GTNNAC	1 cut(s)	399
Hpy188I	TCNGA	4 cut(s)	270, 325, 582, 630
Hpy188III	TCNNGA	4 cut(s)	26, 110, 806, 900
Hpy8I	GTNNAC	1 cut(s)	399
HpyAV	CCTTC	1 cut(s)	697
HpyCH4V	TGCA	7 cut(s)	149, 184, 238, 380, 598, 644, 682
HpyF10VI	GCNNNNNNNGC	3 cut(s)	533, 661, 958
HpyF3I	CTNAG	3 cut(s)	393, 579, 807
Hsp92II	CATG	4 cut(s)	415, 436, 837, 850
Ksp22I	TGATCA	1 cut(s)	928
Kzo9I	GATC	3 cut(s)	201, 529, 928
Lsp1109I	GCAGC	5 cut(s)	168, 460, 694, 712, 829
LweI	GCATC	3 cut(s)	267, 367, 601
MaeI	CTAG	1 cut(s)	423
MalI	GATC	3 cut(s)	203, 531, 930
MboI	GATC	3 cut(s)	201, 529, 928
MboII	GAAGA	6 cut(s)	100, 133, 184, 345, 378, 498
MfeI	CAATTG	2 cut(s)	219, 942
MhlI	GDGCHC	1 cut(s)	35
MluCI	AATT	9 cut(s)	91, 219, 464, 546, 553, 853, 895, 915, 942
MlyI	GAGTC	2 cut(s)	115, 808
MmeI	TCCRAC	2 cut(s)	293, 336
MnlI	CCTC	4 cut(s)	329, 588, 684, 812
MseI	TTAA	3 cut(s)	243, 468, 738
MslI	CAYNNNNRTG	1 cut(s)	768
MspA1I	CMGCKG	2 cut(s)	181, 842
MspI	CCGG	1 cut(s)	658
MspR9I	CCNGG	1 cut(s)	658
MunI	CAATTG	2 cut(s)	219, 942
Mva1269I	GAATGC	1 cut(s)	909
MwoI	GCNNNNNNNGC	3 cut(s)	533, 661, 958
NciI	CCSGG	1 cut(s)	658
NdeII	GATC	3 cut(s)	201, 529, 928
NlaIII	CATG	4 cut(s)	415, 436, 837, 850
NmeAIII	GCCGAG	1 cut(s)	933
NspI	RCATGY	1 cut(s)	837
PaeR7I	CTCGAG	1 cut(s)	816
PceI	AGGCCT	1 cut(s)	571
PciI	ACATGT	1 cut(s)	833
PctI	GAATGC	1 cut(s)	909
PfeI	GAWTC	4 cut(s)	124, 308, 365, 419
PkrI	GCNGC	6 cut(s)	183, 450, 684, 727, 844, 954
PleI	GAGTC	2 cut(s)	114, 808
PpsI	GAGTC	2 cut(s)	114, 808
PpuMI	RGGWCCY	1 cut(s)	647
PscI	ACATGT	1 cut(s)	833
Psp5II	RGGWCCY	1 cut(s)	647
PspPI	GGNCC	2 cut(s)	617, 647
PspPPI	RGGWCCY	1 cut(s)	647
PspXI	VCTCGAGB	1 cut(s)	816
PvuII	CAGCTG	2 cut(s)	181, 842
RsaI	GTAC	1 cut(s)	478
RsaNI	GTAC	1 cut(s)	477
RseI	CAYNNNNRTG	1 cut(s)	768
SaqAI	TTAA	3 cut(s)	243, 468, 738
SatI	GCNGC	6 cut(s)	182, 449, 683, 726, 843, 953
Sau3AI	GATC	3 cut(s)	201, 529, 928
Sau96I	GGNCC	2 cut(s)	617, 647
ScaI	AGTACT	1 cut(s)	478
SchI	GAGTC	2 cut(s)	115, 808
ScrFI	CCNGG	1 cut(s)	658
SduI	GDGCHC	1 cut(s)	35
SfaNI	GCATC	3 cut(s)	267, 367, 601
Sfr274I	CTCGAG	1 cut(s)	816
SinI	GGWCC	2 cut(s)	617, 647
SlaI	CTCGAG	1 cut(s)	816
SmiMI	CAYNNNNRTG	1 cut(s)	768
SmlI	CTYRAG	3 cut(s)	71, 295, 816
SmoI	CTYRAG	3 cut(s)	71, 295, 816
Sse9I	AATT	9 cut(s)	91, 219, 464, 546, 553, 853, 895, 915, 942
SseBI	AGGCCT	1 cut(s)	571
SsiI	CCGC	1 cut(s)	952
SspMI	CTAG	1 cut(s)	423
StuI	AGGCCT	1 cut(s)	571
StyD4I	CCNGG	1 cut(s)	656
TaqI	TCGA	1 cut(s)	817
TasI	AATT	9 cut(s)	91, 219, 464, 546, 553, 853, 895, 915, 942
TatI	WGTACW	1 cut(s)	476
TauI	GCSGC	1 cut(s)	955
TfiI	GAWTC	4 cut(s)	124, 308, 365, 419
Tru1I	TTAA	3 cut(s)	243, 468, 738
Tru9I	TTAA	3 cut(s)	243, 468, 738
TscAI	CASTG	3 cut(s)	40, 211, 759
TseI	GCWGC	5 cut(s)	181, 448, 682, 725, 842
TspDTI	ATGAA	6 cut(s)	101, 180, 357, 555, 767, 873
TspRI	CASTG	3 cut(s)	40, 211, 759
VpaK11BI	GGWCC	2 cut(s)	617, 647
XagI	CCTNNNNNAGG	1 cut(s)	582
XapI	RAATTY	3 cut(s)	91, 464, 853
XceI	RCATGY	1 cut(s)	837
XcmI	CCANNNNNNNNNTGG	1 cut(s)	409
XhoI	CTCGAG	1 cut(s)	816
XspI	CTAG	1 cut(s)	423
ZrmI	AGTACT	1 cut(s)	478

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.