Rroxscaffold_2G00095810

Transcription factor JUNGBRUNNEN 1-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
17165004 .. 17165431
428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00095810.1

Sequence Viewer

Length: 231 bp
ATGGAGGTGACAAAGGTTAAATTCAAGGATGATGATGATGAGGAATTAGCAGGTGGGATGCTTCCAGGGTTTCGGTTTCATCCGACCGATGAAGAACTTGTTGGGTTTTATCTGCCGGTTAAGGTGGAGAAGAAAAAGATTAGTACTAGAACTTCTACTAGATTGGATCAACTCATCAGACAGATTGATATCTACAAATATGATCCCTGGGATCTTCCAAAGTCCTCATGA

Protein Analysis

76

Amino Acids

8.91

Weight (kDa)

5.32

Isoelectric Point (pI)

33.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM PF02365 22 - 75 5.1e-13 No apical meristem (NAM) protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 41
Acc36I ACCTGC 1 cut(s) 41
AclWI GGATC 3 cut(s) 174, 197, 219
AcsI RAATTY 1 cut(s) 20
AfaI GTAC 1 cut(s) 145
AgsI TTSAA 1 cut(s) 25
AjnI CCWGG 2 cut(s) 64, 206
AjuI GAANNNNNNNTTGG 2 cut(s) 84, 116
AlwI GGATC 3 cut(s) 174, 197, 219
ApoI RAATTY 1 cut(s) 20
AsuHPI GGTGA 1 cut(s) 19
BarI GAAGNNNNNNTAC 2 cut(s) 136, 168
BciT130I CCWGG 2 cut(s) 66, 208
BfaI CTAG 2 cut(s) 147, 159
BfuAI ACCTGC 1 cut(s) 41
BmcAI AGTACT 1 cut(s) 145
Bme1390I CCNGG 2 cut(s) 66, 208
BmrFI CCNGG 2 cut(s) 66, 208
BmsI GCATC 1 cut(s) 48
BsaBI GATNNNNATC 1 cut(s) 188
BsaJI CCNNGG 3 cut(s) 65, 206, 207
Bse118I RCCGGY 1 cut(s) 115
Bse8I GATNNNNATC 1 cut(s) 188
BseBI CCWGG 2 cut(s) 66, 208
BseDI CCNNGG 3 cut(s) 65, 206, 207
BseGI GGATG 3 cut(s) 34, 63, 79
BseJI GATNNNNATC 1 cut(s) 188
Bsh1285I CGRYCG 1 cut(s) 87
BsiEI CGRYCG 1 cut(s) 87
BsiSI CCGG 1 cut(s) 116
Bsp143I GATC 3 cut(s) 166, 202, 211
BspHI TCATGA 1 cut(s) 227
BspMI ACCTGC 1 cut(s) 41
BspPI GGATC 3 cut(s) 174, 197, 219
BsrFI RCCGGY 1 cut(s) 115
BssAI RCCGGY 1 cut(s) 115
BssECI CCNNGG 3 cut(s) 65, 206, 207
BssMI GATC 3 cut(s) 166, 202, 211
Bst2UI CCWGG 2 cut(s) 66, 208
BstF5I GGATG 3 cut(s) 34, 63, 79
BstKTI GATC 3 cut(s) 169, 205, 214
BstMBI GATC 3 cut(s) 166, 202, 211
BstMCI CGRYCG 1 cut(s) 87
BstNI CCWGG 2 cut(s) 66, 208
BstSCI CCNGG 2 cut(s) 64, 206
BstX2I RGATCY 1 cut(s) 211
BstYI RGATCY 1 cut(s) 211
BtsCI GGATG 3 cut(s) 34, 63, 79
BveI ACCTGC 1 cut(s) 41
CciI TCATGA 1 cut(s) 227
Cfr10I RCCGGY 1 cut(s) 115
Csp6I GTAC 1 cut(s) 144
CviAII CATG 1 cut(s) 228
CviQI GTAC 1 cut(s) 144
DpnI GATC 3 cut(s) 168, 204, 213
DpnII GATC 3 cut(s) 166, 202, 211
Eco32I GATATC 1 cut(s) 190
EcoRII CCWGG 2 cut(s) 64, 206
EcoRV GATATC 1 cut(s) 190
FaeI CATG 1 cut(s) 231
FaiI YATR 2 cut(s) 201, 229
FatI CATG 1 cut(s) 227
FokI GGATG 3 cut(s) 41, 66, 70
FspBI CTAG 2 cut(s) 147, 159
HapII CCGG 1 cut(s) 116
Hin1II CATG 1 cut(s) 231
HpaII CCGG 1 cut(s) 116
HphI GGTGA 1 cut(s) 19
Hpy188I TCNGA 2 cut(s) 84, 179
Hpy188III TCNNGA 1 cut(s) 228
Hsp92II CATG 1 cut(s) 231
Kzo9I GATC 3 cut(s) 166, 202, 211
LpnPI CCDG 6 cut(s) 36, 51, 78, 129, 193, 220
LweI GCATC 1 cut(s) 48
MaeI CTAG 2 cut(s) 147, 159
MaeIII GTNAC 1 cut(s) 7
MalI GATC 3 cut(s) 168, 204, 213
MboI GATC 3 cut(s) 166, 202, 211
MboII GAAGA 3 cut(s) 104, 142, 206
MflI RGATCY 1 cut(s) 211
MluCI AATT 2 cut(s) 20, 44
MmeI TCCRAC 1 cut(s) 107
MnlI CCTC 1 cut(s) 34
MseI TTAA 2 cut(s) 18, 120
MspI CCGG 1 cut(s) 116
MspR9I CCNGG 2 cut(s) 66, 208
MvaI CCWGG 2 cut(s) 66, 208
NdeII GATC 3 cut(s) 166, 202, 211
NlaIII CATG 1 cut(s) 231
NmuCI GTSAC 1 cut(s) 7
PagI TCATGA 1 cut(s) 227
PaqCI CACCTGC 1 cut(s) 41
PasI CCCWGGG 1 cut(s) 207
Psp6I CCWGG 2 cut(s) 64, 206
PspGI CCWGG 2 cut(s) 64, 206
PsuI RGATCY 1 cut(s) 211
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SaqAI TTAA 2 cut(s) 18, 120
Sau3AI GATC 3 cut(s) 166, 202, 211
ScaI AGTACT 1 cut(s) 145
ScrFI CCNGG 2 cut(s) 66, 208
SetI ASST 4 cut(s) 9, 18, 55, 126
SfaNI GCATC 1 cut(s) 48
Sse9I AATT 2 cut(s) 20, 44
SspMI CTAG 2 cut(s) 147, 159
StyD4I CCNGG 2 cut(s) 64, 206
TaqII GACCGA 1 cut(s) 101
TasI AATT 2 cut(s) 20, 44
TatI WGTACW 1 cut(s) 143
Tru1I TTAA 2 cut(s) 18, 120
Tru9I TTAA 2 cut(s) 18, 120
TseFI GTSAC 1 cut(s) 7
Tsp45I GTSAC 1 cut(s) 7
TspDTI ATGAA 2 cut(s) 68, 105
XapI RAATTY 1 cut(s) 20
XspI CTAG 2 cut(s) 147, 159
ZrmI AGTACT 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.