Rroxscaffold_2G00150280

High mobility group B protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
87691203 .. 87694343
3141 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00150280.1

Sequence Viewer

Length: 153 bp
ATGAGCAATGGGTGCCAAAAGGATGTCCTAGTGGCGCTTATAAGCTTTCACAATTGTAGCCTTGATGCCAAAATCAAGACCAACCTGGAGGCTCAAGTCGTGGAAAAGCCCGGTGAAGTGACTAAGAAGCCTCCCACAGAAATAGGAATTTAG

Protein Analysis

50

Amino Acids

5.4

Weight (kDa)

6.53

Isoelectric Point (pI)

13.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 41
AccB1I GGYRCC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 147
AjnI CCWGG 1 cut(s) 84
AluBI AGCT 1 cut(s) 45
AluI AGCT 1 cut(s) 45
ApoI RAATTY 1 cut(s) 147
AspLEI GCGC 1 cut(s) 37
AsuC2I CCSGG 1 cut(s) 111
AsuHPI GGTGA 1 cut(s) 125
BanI GGYRCC 1 cut(s) 12
BciT130I CCWGG 1 cut(s) 86
BcnI CCSGG 1 cut(s) 111
BfaI CTAG 1 cut(s) 29
BfoI RGCGCY 1 cut(s) 38
Bme1390I CCNGG 2 cut(s) 86, 111
BmiI GGNNCC 1 cut(s) 14
BmrFI CCNGG 2 cut(s) 86, 111
BmsI GCATC 1 cut(s) 55
BpmI CTGGAG 1 cut(s) 107
BpuEI CTTGAG 1 cut(s) 78
BpuMI CCSGG 1 cut(s) 111
Bse3DI GCAATG 1 cut(s) 13
BseBI CCWGG 1 cut(s) 86
BseGI GGATG 1 cut(s) 28
BseMI GCAATG 1 cut(s) 13
BshNI GGYRCC 1 cut(s) 12
BsiSI CCGG 1 cut(s) 111
BspLI GGNNCC 1 cut(s) 14
BspT107I GGYRCC 1 cut(s) 12
BsrDI GCAATG 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 86
BstAPI GCANNNNNTGC 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 123
BstF5I GGATG 1 cut(s) 28
BstH2I RGCGCY 1 cut(s) 38
BstHHI GCGC 1 cut(s) 37
BstMWI GCNNNNNNNGC 1 cut(s) 12
BstNI CCWGG 1 cut(s) 86
BstSCI CCNGG 2 cut(s) 84, 109
BtsCI GGATG 1 cut(s) 28
CfoI GCGC 1 cut(s) 37
CviJI RGCY 5 cut(s) 45, 60, 92, 109, 130
CviKI_1 RGCY 5 cut(s) 45, 60, 92, 109, 130
DdeI CTNAG 1 cut(s) 123
EcoRII CCWGG 1 cut(s) 84
FaiI YATR 1 cut(s) 41
FokI GGATG 1 cut(s) 35
FspBI CTAG 1 cut(s) 29
GlaI GCGC 1 cut(s) 36
GsuI CTGGAG 1 cut(s) 107
HaeII RGCGCY 1 cut(s) 38
HapII CCGG 1 cut(s) 111
HhaI GCGC 1 cut(s) 37
Hin6I GCGC 1 cut(s) 35
HinP1I GCGC 1 cut(s) 35
HindIII AAGCTT 1 cut(s) 43
HpaII CCGG 1 cut(s) 111
HphI GGTGA 1 cut(s) 125
Hpy188III TCNNGA 1 cut(s) 76
HpyF10VI GCNNNNNNNGC 1 cut(s) 12
HpyF3I CTNAG 1 cut(s) 123
HspAI GCGC 1 cut(s) 35
LpnPI CCDG 3 cut(s) 71, 98, 124
LweI GCATC 1 cut(s) 55
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 1 cut(s) 118
MfeI CAATTG 1 cut(s) 52
MluCI AATT 2 cut(s) 52, 147
MnlI CCTC 2 cut(s) 82, 141
MspI CCGG 1 cut(s) 111
MspR9I CCNGG 2 cut(s) 86, 111
MunI CAATTG 1 cut(s) 52
MvaI CCWGG 1 cut(s) 86
MwoI GCNNNNNNNGC 1 cut(s) 12
NciI CCSGG 1 cut(s) 111
NlaIV GGNNCC 1 cut(s) 14
NmuCI GTSAC 1 cut(s) 118
PsiI TTATAA 1 cut(s) 41
Psp6I CCWGG 1 cut(s) 84
PspGI CCWGG 1 cut(s) 84
PspN4I GGNNCC 1 cut(s) 14
ScrFI CCNGG 2 cut(s) 86, 111
SetI ASST 2 cut(s) 47, 87
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 9 cut(s) 41, 74, 88, 97, 98, 107, 112, 122, 123
SmlI CTYRAG 1 cut(s) 93
SmoI CTYRAG 1 cut(s) 93
Sse9I AATT 2 cut(s) 52, 147
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 2 cut(s) 84, 109
TasI AATT 2 cut(s) 52, 147
TseFI GTSAC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 118
XapI RAATTY 1 cut(s) 147
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.