Rroxscaffold_4G00314750

Anthranilate synthase beta subunit

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
38843742 .. 38847156
3415 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00314750.1

Sequence Viewer

Length: 180 bp
ATGTTCCATCCTGAAAGTATCATCACTTCCGAAGGCGGGACAATCGTTCGCAACTTTGTAAAACTGATCGAGAAAAGTGAGTCGGAATCGAGAATAACTAGAGGTTTGGTTTGTCTACACAAGTGTAATGTAATGTATCGGATCAATATATATTTATGGGCCTTTAAGTCAGCTCGCTAG

Protein Analysis

59

Amino Acids

6.87

Weight (kDa)

9.51

Isoelectric Point (pI)

52.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 115
AciI CCGC 1 cut(s) 36
AclWI GGATC 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 36
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
AlwI GGATC 1 cut(s) 149
AoxI GGCC 1 cut(s) 159
AspS9I GGNCC 1 cut(s) 159
BarI GAAGNNNNNNTAC 2 cut(s) 10, 42
BccI CCATC 1 cut(s) 15
BfaI CTAG 2 cut(s) 99, 178
BmgT120I GGNCC 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 36
BseGI GGATG 1 cut(s) 7
BseLI CCNNNNNNNGG 1 cut(s) 36
BshFI GGCC 1 cut(s) 161
BslFI GGGAC 1 cut(s) 52
BslI CCNNNNNNNGG 1 cut(s) 36
BsmFI GGGAC 1 cut(s) 52
BsnI GGCC 1 cut(s) 161
Bsp143I GATC 2 cut(s) 66, 141
BspACI CCGC 1 cut(s) 36
BspANI GGCC 1 cut(s) 161
BspPI GGATC 1 cut(s) 149
BssMI GATC 2 cut(s) 66, 141
BstC8I GCNNGC 1 cut(s) 175
BstF5I GGATG 1 cut(s) 7
BstKTI GATC 2 cut(s) 69, 144
BstMBI GATC 2 cut(s) 66, 141
BsuRI GGCC 1 cut(s) 161
BtsCI GGATG 1 cut(s) 7
Cac8I GCNNGC 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 159
CviJI RGCY 2 cut(s) 161, 173
CviKI_1 RGCY 2 cut(s) 161, 173
DpnI GATC 2 cut(s) 68, 143
DpnII GATC 2 cut(s) 66, 141
FaiI YATR 3 cut(s) 149, 151, 157
FaqI GGGAC 1 cut(s) 52
FauI CCCGC 1 cut(s) 29
FblI GTMKAC 1 cut(s) 115
FspBI CTAG 2 cut(s) 99, 178
HaeIII GGCC 1 cut(s) 161
HinfI GANTC 2 cut(s) 80, 86
Hpy166II GTNNAC 1 cut(s) 116
Hpy188I TCNGA 3 cut(s) 31, 85, 141
Hpy188III TCNNGA 3 cut(s) 11, 70, 90
Hpy8I GTNNAC 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 26
Kzo9I GATC 2 cut(s) 66, 141
LpnPI CCDG 1 cut(s) 24
MaeI CTAG 2 cut(s) 99, 178
MalI GATC 2 cut(s) 68, 143
MboI GATC 2 cut(s) 66, 141
MlyI GAGTC 1 cut(s) 89
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 1 cut(s) 95
MseI TTAA 1 cut(s) 165
NdeII GATC 2 cut(s) 66, 141
PfeI GAWTC 1 cut(s) 86
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
PspPI GGNCC 1 cut(s) 159
SaqAI TTAA 1 cut(s) 165
Sau3AI GATC 2 cut(s) 66, 141
Sau96I GGNCC 1 cut(s) 159
SchI GAGTC 1 cut(s) 89
SetI ASST 2 cut(s) 106, 175
SgeI CNNG 6 cut(s) 23, 49, 82, 102, 111, 133
SsiI CCGC 1 cut(s) 36
SspMI CTAG 2 cut(s) 99, 178
TaqI TCGA 2 cut(s) 69, 89
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
XmiI GTMKAC 1 cut(s) 115
XspI CTAG 2 cut(s) 99, 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.