Rroxscaffold_6G00396470

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
18004047 .. 18004890
844 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00396470.1

Sequence Viewer

Length: 222 bp
ATGCGTTCTAAAAAAAATAGAAAAACCATTCACTTTGGGAAAAGAAGCGAACAGATCTCTCTCCCTCTCGCTTCACCATCTATCCTTCTCTTCACCGAGTATGTGGAGAAATCTCTCATCACCTTCTTGACGATTGTAGCTTTTCTCCGGGAAATTGGGCAATCTAATGTTCCATCATCATTTGCTCCTACCAATGTTGTTGCATCTTCATCGTCTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.04

Weight (kDa)

10.28

Isoelectric Point (pI)

77.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AsuC2I CCSGG 1 cut(s) 149
AsuHPI GGTGA 3 cut(s) 66, 85, 112
BbsI GAAGAC 1 cut(s) 207
BccI CCATC 2 cut(s) 85, 181
BcgI CGANNNNNNTGC 1 cut(s) 192
BcnI CCSGG 1 cut(s) 149
BglII AGATCT 1 cut(s) 54
Bme1390I CCNGG 1 cut(s) 149
BmrFI CCNGG 1 cut(s) 149
BmsI GCATC 1 cut(s) 212
BpiI GAAGAC 1 cut(s) 207
BpuMI CCSGG 1 cut(s) 149
BsiSI CCGG 1 cut(s) 148
Bsp143I GATC 1 cut(s) 54
BssMI GATC 1 cut(s) 54
Bst6I CTCTTC 1 cut(s) 95
BstKTI GATC 1 cut(s) 57
BstMBI GATC 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 147
BstV2I GAAGAC 1 cut(s) 207
BstX2I RGATCY 1 cut(s) 54
BstYI RGATCY 1 cut(s) 54
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
Eam1104I CTCTTC 1 cut(s) 95
EarI CTCTTC 1 cut(s) 95
FaiI YATR 2 cut(s) 102, 220
HapII CCGG 1 cut(s) 148
HpaII CCGG 1 cut(s) 148
HphI GGTGA 3 cut(s) 66, 85, 112
Hpy188III TCNNGA 1 cut(s) 127
HpyAV CCTTC 2 cut(s) 95, 133
HpyCH4V TGCA 1 cut(s) 203
Kzo9I GATC 1 cut(s) 54
LmnI GCTCC 1 cut(s) 190
LpnPI CCDG 1 cut(s) 161
LweI GCATC 1 cut(s) 212
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MboII GAAGA 3 cut(s) 82, 198, 207
MflI RGATCY 1 cut(s) 54
MluCI AATT 1 cut(s) 153
MnlI CCTC 1 cut(s) 75
MspI CCGG 1 cut(s) 148
MspR9I CCNGG 1 cut(s) 149
NciI CCSGG 1 cut(s) 149
NdeII GATC 1 cut(s) 54
PfoI TCCNGGA 1 cut(s) 147
PsuI RGATCY 1 cut(s) 54
Sau3AI GATC 1 cut(s) 54
ScrFI CCNGG 1 cut(s) 149
SetI ASST 2 cut(s) 125, 142
SfaNI GCATC 1 cut(s) 212
SgeI CNNG 5 cut(s) 80, 109, 139, 160, 161
Sse9I AATT 1 cut(s) 153
StyD4I CCNGG 1 cut(s) 147
TasI AATT 1 cut(s) 153
TspDTI ATGAA 2 cut(s) 198, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.