Rh6BG131700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
20603260 .. 20622753
19494 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG131700.1

Sequence Viewer

Length: 216 bp
ATGCAACCAAAGATACTTGAGTTCATTGTATACTTAAGATACAAAATCAGGACAGTGGAGCTAGATGGGAAGACAGTCAAGCTGCAGATTGTGAGTAGGAGTTGCTTTGTTTTCCACTTAGGTGTTTATGTTGGTGTAGAAGAGGACGGAAGCACTGAAGATGATGATGGTTTAGGAGATGCATGGATGGAAATTAAGTGTCTTGATGTCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.14

Weight (kDa)

4.78

Isoelectric Point (pI)

42.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 30
AcuI CTGAAG 1 cut(s) 177
AflII CTTAAG 1 cut(s) 34
AleI CACNNNNGTG 1 cut(s) 120
AluBI AGCT 2 cut(s) 61, 82
AluI AGCT 2 cut(s) 61, 82
ApeKI GCWGC 1 cut(s) 82
BaeI ACNNNNGTAYC 1 cut(s) 38
BbsI GAAGAC 1 cut(s) 77
BbvI GCAGC 1 cut(s) 69
BccI CCATC 3 cut(s) 59, 161, 181
BfaI CTAG 1 cut(s) 62
BfmI CTRYAG 1 cut(s) 83
BfrI CTTAAG 1 cut(s) 34
BisI GCNGC 1 cut(s) 83
BlsI GCNGC 1 cut(s) 84
BmsI GCATC 1 cut(s) 169
BpiI GAAGAC 1 cut(s) 77
BpuEI CTTGAG 1 cut(s) 38
BseGI GGATG 1 cut(s) 192
BseXI GCAGC 1 cut(s) 69
BspMAI CTGCAG 1 cut(s) 87
BspTI CTTAAG 1 cut(s) 34
BssNAI GTATAC 1 cut(s) 31
Bst1107I GTATAC 1 cut(s) 31
Bst4CI ACNGT 2 cut(s) 55, 76
Bst6I CTCTTC 1 cut(s) 135
BstAFI CTTAAG 1 cut(s) 34
BstDEI CTNAG 1 cut(s) 118
BstF5I GGATG 1 cut(s) 192
BstSFI CTRYAG 1 cut(s) 83
BstV1I GCAGC 1 cut(s) 69
BstV2I GAAGAC 1 cut(s) 77
BstZ17I GTATAC 1 cut(s) 31
BtsCI GGATG 1 cut(s) 192
BtsIMutI CAGTG 2 cut(s) 60, 153
CviAII CATG 1 cut(s) 183
CviJI RGCY 2 cut(s) 61, 82
CviKI_1 RGCY 2 cut(s) 61, 82
DdeI CTNAG 1 cut(s) 118
Eam1104I CTCTTC 1 cut(s) 135
EarI CTCTTC 1 cut(s) 135
Eco57I CTGAAG 1 cut(s) 177
EcoT22I ATGCAT 1 cut(s) 184
FaeI CATG 1 cut(s) 186
FaiI YATR 3 cut(s) 31, 129, 184
FatI CATG 1 cut(s) 182
FblI GTMKAC 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 83
FokI GGATG 1 cut(s) 199
Fsp4HI GCNGC 1 cut(s) 83
FspBI CTAG 1 cut(s) 62
GluI GCNGC 1 cut(s) 83
Hin1II CATG 1 cut(s) 186
Hpy166II GTNNAC 1 cut(s) 31
Hpy188III TCNNGA 2 cut(s) 49, 203
Hpy8I GTNNAC 1 cut(s) 31
HpyCH4III ACNGT 2 cut(s) 55, 76
HpyCH4V TGCA 3 cut(s) 4, 85, 182
HpyF3I CTNAG 1 cut(s) 118
Hsp92II CATG 1 cut(s) 186
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 1 cut(s) 34
Lsp1109I GCAGC 1 cut(s) 69
LweI GCATC 1 cut(s) 169
MaeI CTAG 1 cut(s) 62
MboII GAAGA 3 cut(s) 82, 152, 170
MluCI AATT 1 cut(s) 192
MnlI CCTC 1 cut(s) 136
Mph1103I ATGCAT 1 cut(s) 184
MseI TTAA 2 cut(s) 35, 195
MslI CAYNNNNRTG 1 cut(s) 120
MspCI CTTAAG 1 cut(s) 34
NlaIII CATG 1 cut(s) 186
NsiI ATGCAT 1 cut(s) 184
OliI CACNNNNGTG 1 cut(s) 120
PkrI GCNGC 1 cut(s) 84
PstI CTGCAG 1 cut(s) 87
RseI CAYNNNNRTG 1 cut(s) 120
SaqAI TTAA 2 cut(s) 35, 195
SatI GCNGC 1 cut(s) 83
SetI ASST 3 cut(s) 63, 84, 124
SfaNI GCATC 1 cut(s) 169
SfcI CTRYAG 1 cut(s) 83
SgeI CNNG 5 cut(s) 29, 61, 74, 91, 195
SmiMI CAYNNNNRTG 1 cut(s) 120
SmlI CTYRAG 2 cut(s) 17, 34
SmoI CTYRAG 2 cut(s) 17, 34
Sse9I AATT 1 cut(s) 192
SspMI CTAG 1 cut(s) 62
TaaI ACNGT 2 cut(s) 55, 76
TasI AATT 1 cut(s) 192
Tru1I TTAA 2 cut(s) 35, 195
Tru9I TTAA 2 cut(s) 35, 195
TscAI CASTG 2 cut(s) 60, 160
TseI GCWGC 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 13
TspGWI ACGGA 1 cut(s) 162
TspRI CASTG 2 cut(s) 60, 160
Vha464I CTTAAG 1 cut(s) 34
XmiI GTMKAC 1 cut(s) 30
XspI CTAG 1 cut(s) 62
Zsp2I ATGCAT 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.