Rorug04G0291900

nuclear matrix constituent protein 1-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
46569985 .. 46570296
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0291900.1

Sequence Viewer

Length: 312 bp
ATGGCCACCTCGGATTTCAGGGTGAAATTTCAGGACGGGTCTTGTCACTTCCCTTGTTTCAAACAATTCTTTCCTATTTTTATCAACAACATGAAACAACCTACCAACCTACGACGCTACAAAGTTCCAATTACTCGCTCGATTCAGTTCAAAGTTAGTCATATCTATAGGGAGGGGAATACAGTAGCGGATGCTTTAGCAAACTATGGTTCCTCTAATATTGGCTCTAGCTGGTGGGATGTTTTACCAGCCTTCATAGCTGGCTCATATGGGTGCGACCTGTCCTCTGCAAATGTTCACAGGTTTCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.76

Weight (kDa)

9.41

Isoelectric Point (pI)

46.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 188
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 26
AgsI TTSAA 2 cut(s) 61, 151
AluBI AGCT 2 cut(s) 231, 260
AluI AGCT 2 cut(s) 231, 260
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 26
AsuHPI GGTGA 1 cut(s) 34
BalI TGGCCA 1 cut(s) 5
BfaI CTAG 1 cut(s) 228
BfmI CTRYAG 1 cut(s) 166
BmiI GGNNCC 1 cut(s) 211
BmsI GCATC 1 cut(s) 181
BsaJI CCNNGG 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 2 cut(s) 196, 244
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
BspACI CCGC 1 cut(s) 188
BspANI GGCC 1 cut(s) 5
BspLI GGNNCC 1 cut(s) 211
BssECI CCNNGG 1 cut(s) 9
Bst4CI ACNGT 1 cut(s) 184
BstC8I GCNNGC 1 cut(s) 262
BstF5I GGATG 2 cut(s) 196, 244
BstMWI GCNNNNNNNGC 1 cut(s) 257
BstSFI CTRYAG 1 cut(s) 166
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 2 cut(s) 196, 244
Cac8I GCNNGC 1 cut(s) 262
CseI GACGC 1 cut(s) 123
CviAII CATG 1 cut(s) 91
CviJI RGCY 6 cut(s) 5, 225, 231, 251, 260, 264
CviKI_1 RGCY 6 cut(s) 5, 225, 231, 251, 260, 264
EaeI YGGCCR 1 cut(s) 3
FaeI CATG 1 cut(s) 94
FaiI YATR 7 cut(s) 92, 162, 168, 207, 257, 268, 270
FatI CATG 1 cut(s) 90
FauNDI CATATG 1 cut(s) 268
FokI GGATG 2 cut(s) 203, 251
FspBI CTAG 1 cut(s) 228
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 123
Hin1II CATG 1 cut(s) 94
HinfI GANTC 1 cut(s) 142
HphI GGTGA 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 298
Hpy188I TCNGA 1 cut(s) 13
Hpy188III TCNNGA 1 cut(s) 32
Hpy8I GTNNAC 1 cut(s) 298
Hpy99I CGWCG 1 cut(s) 117
HpyAV CCTTC 1 cut(s) 262
HpyCH4III ACNGT 1 cut(s) 184
HpyCH4V TGCA 1 cut(s) 290
HpyF10VI GCNNNNNNNGC 1 cut(s) 257
Hsp92II CATG 1 cut(s) 94
LpnPI CCDG 7 cut(s) 4, 17, 217, 246, 261, 286, 293
LweI GCATC 1 cut(s) 181
MaeI CTAG 1 cut(s) 228
MaeIII GTNAC 1 cut(s) 44
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 26, 65, 129
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 4 cut(s) 19, 166, 223, 295
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 271
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 257
NdeI CATATG 1 cut(s) 268
NlaIII CATG 1 cut(s) 94
NlaIV GGNNCC 1 cut(s) 211
NmuCI GTSAC 1 cut(s) 44
PfeI GAWTC 1 cut(s) 142
PspN4I GGNNCC 1 cut(s) 211
RseI CAYNNNNRTG 1 cut(s) 271
SetI ASST 7 cut(s) 11, 103, 111, 233, 262, 282, 305
SfaNI GCATC 1 cut(s) 181
SfcI CTRYAG 1 cut(s) 166
SmiMI CAYNNNNRTG 1 cut(s) 271
Sse9I AATT 3 cut(s) 26, 65, 129
SsiI CCGC 1 cut(s) 188
SspI AATATT 1 cut(s) 220
SspMI CTAG 1 cut(s) 228
TaaI ACNGT 1 cut(s) 184
TaqI TCGA 1 cut(s) 140
TasI AATT 3 cut(s) 26, 65, 129
TfiI GAWTC 1 cut(s) 142
TseFI GTSAC 1 cut(s) 44
Tsp45I GTSAC 1 cut(s) 44
TspDTI ATGAA 3 cut(s) 107, 244, 296
XapI RAATTY 1 cut(s) 26
XspI CTAG 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.