Rh4CG369600

nuclear matrix constituent protein 1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
62388276 .. 62388521
246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG369600.1

Sequence Viewer

Length: 246 bp
ATGGAGGCGGATGATGGGTATGCTCCATCAATTGACGATCACAGTTTCATTGACAGCCATGAGCAAGACATTCCAGAAGATTCTGAGCAATCAGAGCTGAAAAGTGGCCGACGAAAACCAGCTAGGGGATGCAAATCTAGATTGTCTAGAACACACTCAGTGAAGGCAGTTGTTGAAGACGCAAAGAAATTTTTAGGAGAAACTCCAGAAGCATCAAATGCAAGTTTGCTCAATGAGAGTAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.93

Weight (kDa)

5.09

Isoelectric Point (pI)

58.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 8
AcoI YGGCCR 1 cut(s) 106
AcsI RAATTY 1 cut(s) 188
AdeI CACNNNGTG 1 cut(s) 160
AfiI CCNNNNNNNGG 1 cut(s) 125
AgsI TTSAA 1 cut(s) 176
AluBI AGCT 2 cut(s) 97, 122
AluI AGCT 2 cut(s) 97, 122
AoxI GGCC 1 cut(s) 106
ApoI RAATTY 1 cut(s) 188
BbsI GAAGAC 1 cut(s) 183
BccI CCATC 2 cut(s) 8, 34
BfaI CTAG 3 cut(s) 123, 138, 147
BmsI GCATC 2 cut(s) 119, 221
BpiI GAAGAC 1 cut(s) 183
BpmI CTGGAG 1 cut(s) 189
BsaBI GATNNNNATC 1 cut(s) 133
Bsc4I CCNNNNNNNGG 1 cut(s) 125
Bse8I GATNNNNATC 1 cut(s) 133
BseGI GGATG 2 cut(s) 16, 134
BseJI GATNNNNATC 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 125
BseMII CTCAG 2 cut(s) 75, 171
BshFI GGCC 1 cut(s) 108
BslI CCNNNNNNNGG 1 cut(s) 125
BsnI GGCC 1 cut(s) 108
Bsp143I GATC 1 cut(s) 37
BspACI CCGC 1 cut(s) 8
BspANI GGCC 1 cut(s) 108
BspCNI CTCAG 2 cut(s) 76, 170
BssMI GATC 1 cut(s) 37
Bst4CI ACNGT 1 cut(s) 44
BstAPI GCANNNNNTGC 1 cut(s) 218
BstDEI CTNAG 2 cut(s) 84, 157
BstF5I GGATG 2 cut(s) 16, 134
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstMWI GCNNNNNNNGC 2 cut(s) 94, 218
BstV2I GAAGAC 1 cut(s) 183
BsuRI GGCC 1 cut(s) 108
BtsCI GGATG 2 cut(s) 16, 134
BtsIMutI CAGTG 1 cut(s) 165
CseI GACGC 1 cut(s) 188
CviAII CATG 1 cut(s) 59
CviJI RGCY 4 cut(s) 57, 97, 108, 122
CviKI_1 RGCY 4 cut(s) 57, 97, 108, 122
DdeI CTNAG 2 cut(s) 84, 157
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
DraIII CACNNNGTG 1 cut(s) 160
EaeI YGGCCR 1 cut(s) 106
EciI GGCGGA 1 cut(s) 23
FaeI CATG 1 cut(s) 62
FaiI YATR 2 cut(s) 21, 60
FatI CATG 1 cut(s) 58
FokI GGATG 2 cut(s) 23, 141
FspBI CTAG 3 cut(s) 123, 138, 147
GsuI CTGGAG 1 cut(s) 189
HaeIII GGCC 1 cut(s) 108
HgaI GACGC 1 cut(s) 188
Hin1II CATG 1 cut(s) 62
HinfI GANTC 1 cut(s) 80
Hpy188I TCNGA 2 cut(s) 85, 94
Hpy188III TCNNGA 4 cut(s) 74, 138, 147, 206
Hpy99I CGWCG 1 cut(s) 114
HpyAV CCTTC 1 cut(s) 157
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 2 cut(s) 132, 221
HpyF10VI GCNNNNNNNGC 2 cut(s) 94, 218
HpyF3I CTNAG 2 cut(s) 84, 157
Hsp92II CATG 1 cut(s) 62
Kzo9I GATC 1 cut(s) 37
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 3 cut(s) 87, 132, 219
LweI GCATC 2 cut(s) 119, 221
MaeI CTAG 3 cut(s) 123, 138, 147
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 2 cut(s) 89, 188
MfeI CAATTG 1 cut(s) 30
MluCI AATT 2 cut(s) 30, 188
MunI CAATTG 1 cut(s) 30
MwoI GCNNNNNNNGC 2 cut(s) 94, 218
NdeII GATC 1 cut(s) 37
NlaIII CATG 1 cut(s) 62
PfeI GAWTC 1 cut(s) 80
Sau3AI GATC 1 cut(s) 37
SetI ASST 2 cut(s) 99, 124
SfaNI GCATC 2 cut(s) 119, 221
SgeI CNNG 9 cut(s) 71, 77, 86, 131, 135, 150, 159, 218, 234
Sse9I AATT 2 cut(s) 30, 188
SsiI CCGC 1 cut(s) 8
SspMI CTAG 3 cut(s) 123, 138, 147
TaaI ACNGT 1 cut(s) 44
TasI AATT 2 cut(s) 30, 188
TfiI GAWTC 1 cut(s) 80
TscAI CASTG 1 cut(s) 165
TspDTI ATGAA 1 cut(s) 37
TspRI CASTG 1 cut(s) 165
XapI RAATTY 1 cut(s) 188
XbaI TCTAGA 2 cut(s) 137, 146
XspI CTAG 3 cut(s) 123, 138, 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.