Rh1CG170200

GTP-binding protein involved in nucleocytoplasmic transport. Required for the import of protein into the nucleus and also for RNA export. Involved in chromatin condensation and control of cell cycle

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
37342599 .. 37345730
3132 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG170200.1

Sequence Viewer

Length: 288 bp
ATGAAGAACAATACCAGATCCGGGACACCCACCGCCACCCTCCTCCAACCTACCATCAAGGGATCGCCTGCTTTCTCAGCGCCACTCGCACTACTGCTTTTCGACCTCAAAAACTCAAATGCTTTGCCGAATCAGCAGACCGTGGAGTACCCGAGCTTCAAGCTCGTAATCATTGGTGATGGTGGAACAGATTTTCATCAAGGTTCCATTCTGGTACTATGGTCTCCACTCTTGCCTCAACGAACAAAGAGCAAGTTTGTTGTGGTCCCTGAGACCCTTCTCAAGTAA

Protein Analysis

95

Amino Acids

10.32

Weight (kDa)

9.78

Isoelectric Point (pI)

45.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 33
AclWI GGATC 2 cut(s) 12, 70
AfaI GTAC 2 cut(s) 149, 216
AfiI CCNNNNNNNGG 1 cut(s) 21
AgsI TTSAA 1 cut(s) 160
AluBI AGCT 2 cut(s) 156, 163
AluI AGCT 2 cut(s) 156, 163
Alw26I GTCTC 2 cut(s) 228, 266
AlwI GGATC 2 cut(s) 12, 70
Ama87I CYCGRG 1 cut(s) 151
AspLEI GCGC 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 265
AsuC2I CCSGG 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 188
AvaI CYCGRG 1 cut(s) 151
AvaII GGWCC 1 cut(s) 265
BaeI ACNNNNGTAYC 2 cut(s) 206, 239
BarI GAAGNNNNNNTAC 2 cut(s) 140, 172
BccI CCATC 2 cut(s) 62, 173
BcnI CCSGG 1 cut(s) 22
BcoDI GTCTC 2 cut(s) 228, 266
BfoI RGCGCY 1 cut(s) 83
Bme1390I CCNGG 1 cut(s) 22
Bme18I GGWCC 1 cut(s) 265
BmeT110I CYCGRG 1 cut(s) 151
BmgT120I GGNCC 1 cut(s) 265
BmiI GGNNCC 2 cut(s) 205, 267
BmrFI CCNGG 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 266
BpuMI CCSGG 1 cut(s) 22
BsaBI GATNNNNATC 1 cut(s) 195
BsaI GGTCTC 2 cut(s) 228, 266
BsaJI CCNNGG 1 cut(s) 141
Bsc4I CCNNNNNNNGG 1 cut(s) 21
Bse8I GATNNNNATC 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 141
BseJI GATNNNNATC 1 cut(s) 195
BseLI CCNNNNNNNGG 1 cut(s) 21
BseMII CTCAG 2 cut(s) 90, 261
BseRI GAGGAG 1 cut(s) 32
BsiHKCI CYCGRG 1 cut(s) 151
BsiSI CCGG 1 cut(s) 21
BslFI GGGAC 2 cut(s) 37, 251
BslI CCNNNNNNNGG 1 cut(s) 21
BsmAI GTCTC 2 cut(s) 228, 266
BsmFI GGGAC 2 cut(s) 37, 251
Bso31I GGTCTC 2 cut(s) 228, 266
BsoBI CYCGRG 1 cut(s) 151
Bsp143I GATC 2 cut(s) 17, 62
BspACI CCGC 1 cut(s) 33
BspCNI CTCAG 2 cut(s) 89, 262
BspLI GGNNCC 2 cut(s) 205, 267
BspPI GGATC 2 cut(s) 12, 70
BspTNI GGTCTC 2 cut(s) 228, 266
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 2 cut(s) 17, 62
Bst4CI ACNGT 1 cut(s) 142
BstC8I GCNNGC 1 cut(s) 69
BstDEI CTNAG 2 cut(s) 76, 270
BstDSI CCRYGG 1 cut(s) 141
BstH2I RGCGCY 1 cut(s) 83
BstHHI GCGC 1 cut(s) 82
BstKTI GATC 2 cut(s) 20, 65
BstMAI GTCTC 2 cut(s) 228, 266
BstMBI GATC 2 cut(s) 17, 62
BstMWI GCNNNNNNNGC 3 cut(s) 77, 86, 133
BstSCI CCNGG 1 cut(s) 20
BstX2I RGATCY 1 cut(s) 17
BstYI RGATCY 1 cut(s) 17
BtgI CCRYGG 1 cut(s) 141
Cac8I GCNNGC 1 cut(s) 69
CfoI GCGC 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 265
Csp6I GTAC 2 cut(s) 148, 215
CviJI RGCY 2 cut(s) 156, 163
CviKI_1 RGCY 2 cut(s) 156, 163
CviQI GTAC 2 cut(s) 148, 215
DdeI CTNAG 2 cut(s) 76, 270
DpnI GATC 2 cut(s) 19, 64
DpnII GATC 2 cut(s) 17, 62
Eco31I GGTCTC 2 cut(s) 228, 266
Eco47I GGWCC 1 cut(s) 265
Eco88I CYCGRG 1 cut(s) 151
FaiI YATR 1 cut(s) 220
FaqI GGGAC 2 cut(s) 37, 251
GlaI GCGC 1 cut(s) 81
HaeII RGCGCY 1 cut(s) 83
HapII CCGG 1 cut(s) 21
HhaI GCGC 1 cut(s) 82
Hin6I GCGC 1 cut(s) 80
HinP1I GCGC 1 cut(s) 80
HinfI GANTC 1 cut(s) 130
HpaII CCGG 1 cut(s) 21
HphI GGTGA 1 cut(s) 188
HpyAV CCTTC 1 cut(s) 287
HpyCH4III ACNGT 1 cut(s) 142
HpyF10VI GCNNNNNNNGC 3 cut(s) 77, 86, 133
HpyF3I CTNAG 2 cut(s) 76, 270
HspAI GCGC 1 cut(s) 80
Kzo9I GATC 2 cut(s) 17, 62
LpnPI CCDG 5 cut(s) 28, 34, 81, 197, 282
MalI GATC 2 cut(s) 19, 64
MboI GATC 2 cut(s) 17, 62
MboII GAAGA 1 cut(s) 16
MflI RGATCY 1 cut(s) 17
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 4 cut(s) 50, 53, 116, 246
MspI CCGG 1 cut(s) 21
MspR9I CCNGG 1 cut(s) 22
MwoI GCNNNNNNNGC 3 cut(s) 77, 86, 133
NciI CCSGG 1 cut(s) 22
NdeII GATC 2 cut(s) 17, 62
NlaIV GGNNCC 2 cut(s) 205, 267
PfeI GAWTC 1 cut(s) 130
PfoI TCCNGGA 1 cut(s) 20
PspN4I GGNNCC 2 cut(s) 205, 267
PspPI GGNCC 1 cut(s) 265
PsuI RGATCY 1 cut(s) 17
RsaI GTAC 2 cut(s) 149, 216
RsaNI GTAC 2 cut(s) 148, 215
Sau3AI GATC 2 cut(s) 17, 62
Sau96I GGNCC 1 cut(s) 265
ScrFI CCNGG 1 cut(s) 22
SetI ASST 5 cut(s) 52, 108, 158, 165, 205
SinI GGWCC 1 cut(s) 265
SmlI CTYRAG 1 cut(s) 281
SmoI CTYRAG 1 cut(s) 281
SsiI CCGC 1 cut(s) 33
StyD4I CCNGG 1 cut(s) 20
TaaI ACNGT 1 cut(s) 142
TaqI TCGA 1 cut(s) 102
TfiI GAWTC 1 cut(s) 130
TspDTI ATGAA 2 cut(s) 17, 185
VpaK11BI GGWCC 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.