Rh1DG076800

Serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0000551
Physical Location & Seq
Forward (+)
14045224 .. 14158517
113294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG076800.1

Sequence Viewer

Length: 153 bp
ATGGACTTCTATGTACGGCAAATACGTGAGCGTGCAAGTGCCAAGGAACTGCTAAAGCACTGCTTTATTAGGACTGCTAGGAAGAGTCCAAGACTTCTTGAGAGAATAAGGATTTTTGGGTGTGAGAACTCTAGCTGGAGAACAAGAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase

Protein Analysis

50

Amino Acids

6.08

Weight (kDa)

11.16

Isoelectric Point (pI)

26.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000551)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G15740
fragaria_vesca FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_7g04581
malus_domestica MD02G1018400.v1.1 MD15G1162400.v1.1 MD17G1217000.v1.1
prunus_persica Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1
pyrus_communis pycom15g14600 pycom17g22160
rosa_chinensis RchiOBHm_Chr1g0325881 RchiOBHm_Chr2g0087081 RchiOBHm_Chr2g0134401 RchiOBHm_Chr6g0252571
rosa_laevigata RLG00000015828 RLG00000019390
rosa_multiflora Rmu_co8182664.1_g000001 Rmu_sc0005550.1_g000003 Rmu_sc0013657.1_g000009 Rmu_ssc0000064.1_g000031
rosa_roxburghii Rroxscaffold_2G00110270 Rroxscaffold_3G00253750 Rroxscaffold_7G00171870
rosa_rugosa Rorug01G0472200 Rorug01G0472300 Rorug02G0316800 Rorug05G0039000 Rorug05G0039100 Rorug06G0116400
rosa_samantha Rh1DG076800 Rh2AG025600 Rh2AG369200 Rh2BG025300 Rh2BG375300 Rh2CG025900 Rh2CG352900 Rh2CG433900 Rh2DG025800 Rh2DG392400 Rh3DG227300 Rh7BG234800 Rh7CG498200
rosa_wichuraiana Rw1G005860 Rw2G002030 Rw2G030080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 15
AluBI AGCT 1 cut(s) 135
AluI AGCT 1 cut(s) 135
BceAI ACGGC 1 cut(s) 32
BfaI CTAG 2 cut(s) 78, 132
BpuEI CTTGAG 1 cut(s) 119
BsaAI YACGTR 1 cut(s) 26
BsaJI CCNNGG 1 cut(s) 42
BseDI CCNNGG 1 cut(s) 42
BssECI CCNNGG 1 cut(s) 42
BssT1I CCWWGG 1 cut(s) 42
Bst6I CTCTTC 1 cut(s) 77
BstBAI YACGTR 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 33
BtsI GCAGTG 1 cut(s) 58
BtsIMutI CAGTG 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 33
Csp6I GTAC 1 cut(s) 14
CviJI RGCY 1 cut(s) 135
CviKI_1 RGCY 1 cut(s) 135
CviQI GTAC 1 cut(s) 14
Eam1104I CTCTTC 1 cut(s) 77
EarI CTCTTC 1 cut(s) 77
Eco130I CCWWGG 1 cut(s) 42
EcoT14I CCWWGG 1 cut(s) 42
ErhI CCWWGG 1 cut(s) 42
FaiI YATR 1 cut(s) 12
FalI AAGNNNNNCTT 2 cut(s) 47, 79
FspBI CTAG 2 cut(s) 78, 132
HinfI GANTC 1 cut(s) 85
Hpy188III TCNNGA 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 25
HpyCH4V TGCA 1 cut(s) 35
HpySE526I ACGT 1 cut(s) 25
LpnPI CCDG 1 cut(s) 121
MaeI CTAG 2 cut(s) 78, 132
MaeII ACGT 1 cut(s) 25
MboII GAAGA 1 cut(s) 94
MlyI GAGTC 1 cut(s) 94
MnlI CCTC 1 cut(s) 140
PcsI WCGNNNNNNNCGW 1 cut(s) 22
PleI GAGTC 1 cut(s) 93
PpsI GAGTC 1 cut(s) 93
Ppu21I YACGTR 1 cut(s) 26
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
SchI GAGTC 1 cut(s) 94
SetI ASST 2 cut(s) 28, 137
SgeI CNNG 9 cut(s) 38, 44, 48, 55, 90, 102, 110, 144, 148
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
SspMI CTAG 2 cut(s) 78, 132
StyI CCWWGG 1 cut(s) 42
TaiI ACGT 1 cut(s) 28
TscAI CASTG 1 cut(s) 65
TspRI CASTG 1 cut(s) 65
XspI CTAG 2 cut(s) 78, 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.