Rh3DG227300

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0000551
Physical Location & Seq
Forward (+)
21464738 .. 21467673
2936 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG227300.1

Sequence Viewer

Length: 207 bp
ATGTTTCAATCTATCGTCGTTTGTGGCATCTTTGAAGAAAAGAATCAATCAATCGCATTTCTCAATTCAAGAAGATATTCCAAAAGTGGGAGTTCAAAGTGCTTGGCAACCTCCTTCTCTCGACTTGCTATAGATATTCAACATGAAAAAGGGCAATGCCCATCCCTCATGGACTTCTACGTACGGCAAATACGTGAGGACAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_5 LRR_6 LRR_8

Protein Analysis

68

Amino Acids

7.81

Weight (kDa)

8.57

Isoelectric Point (pI)

55.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000551)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G15740
fragaria_vesca FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_1g02020 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_6g29180 FvH4_7g04581
malus_domestica MD02G1018400.v1.1 MD15G1162400.v1.1 MD17G1217000.v1.1
prunus_persica Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.3G092900_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1 Prupe.7G252400_v2.0.a1
pyrus_communis pycom15g14600 pycom17g22160
rosa_chinensis RchiOBHm_Chr1g0325881 RchiOBHm_Chr2g0087081 RchiOBHm_Chr2g0134401 RchiOBHm_Chr6g0252571
rosa_laevigata RLG00000015828 RLG00000019390
rosa_multiflora Rmu_co8182664.1_g000001 Rmu_sc0005550.1_g000003 Rmu_sc0013657.1_g000009 Rmu_ssc0000064.1_g000031
rosa_roxburghii Rroxscaffold_2G00110270 Rroxscaffold_3G00253750 Rroxscaffold_7G00171870
rosa_rugosa Rorug01G0472200 Rorug01G0472300 Rorug02G0316800 Rorug05G0039000 Rorug05G0039100 Rorug06G0116400
rosa_samantha Rh1DG076800 Rh2AG025600 Rh2AG369200 Rh2BG025300 Rh2BG375300 Rh2CG025900 Rh2CG352900 Rh2CG433900 Rh2DG025800 Rh2DG392400 Rh3DG227300 Rh7BG234800 Rh7CG498200
rosa_wichuraiana Rw1G005860 Rw2G002030 Rw2G030080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 183
AfiI CCNNNNNNNGG 1 cut(s) 87
AgsI TTSAA 5 cut(s) 8, 35, 69, 96, 140
Asp700I GAANNNNTTC 1 cut(s) 76
BccI CCATC 1 cut(s) 169
BceAI ACGGC 1 cut(s) 200
BfmI CTRYAG 1 cut(s) 129
BmsI GCATC 1 cut(s) 36
BsaAI YACGTR 2 cut(s) 181, 194
Bsc4I CCNNNNNNNGG 1 cut(s) 87
Bse3DI GCAATG 1 cut(s) 161
BseGI GGATG 1 cut(s) 161
BseLI CCNNNNNNNGG 1 cut(s) 87
BseMI GCAATG 1 cut(s) 161
BsiWI CGTACG 1 cut(s) 181
BslI CCNNNNNNNGG 1 cut(s) 87
BsrDI GCAATG 1 cut(s) 161
BstBAI YACGTR 2 cut(s) 181, 194
BstF5I GGATG 1 cut(s) 161
BstSFI CTRYAG 1 cut(s) 129
BstSNI TACGTA 1 cut(s) 181
BtsCI GGATG 1 cut(s) 161
Csp6I GTAC 1 cut(s) 182
CviAII CATG 2 cut(s) 143, 169
CviQI GTAC 1 cut(s) 182
Eco105I TACGTA 1 cut(s) 181
FaeI CATG 2 cut(s) 146, 172
FaiI YATR 3 cut(s) 131, 144, 170
FatI CATG 2 cut(s) 142, 168
FokI GGATG 1 cut(s) 148
Hin1II CATG 2 cut(s) 146, 172
HinfI GANTC 1 cut(s) 43
Hpy188III TCNNGA 2 cut(s) 69, 120
Hpy99I CGWCG 1 cut(s) 20
HpyAV CCTTC 1 cut(s) 124
HpyCH4IV ACGT 2 cut(s) 180, 193
HpySE526I ACGT 2 cut(s) 180, 193
Hsp92II CATG 2 cut(s) 146, 172
LweI GCATC 1 cut(s) 36
MaeII ACGT 2 cut(s) 180, 193
MboII GAAGA 2 cut(s) 47, 84
MluCI AATT 2 cut(s) 64, 202
MnlI CCTC 3 cut(s) 121, 176, 190
MroXI GAANNNNTTC 1 cut(s) 76
MseI TTAA 1 cut(s) 205
NlaIII CATG 2 cut(s) 146, 172
PcsI WCGNNNNNNNCGW 1 cut(s) 190
PdmI GAANNNNTTC 1 cut(s) 76
PfeI GAWTC 1 cut(s) 43
Pfl23II CGTACG 1 cut(s) 181
Ppu21I YACGTR 2 cut(s) 181, 194
PspLI CGTACG 1 cut(s) 181
RsaI GTAC 1 cut(s) 183
RsaNI GTAC 1 cut(s) 182
SaqAI TTAA 1 cut(s) 205
SetI ASST 3 cut(s) 113, 183, 196
SfaNI GCATC 1 cut(s) 36
SfcI CTRYAG 1 cut(s) 129
SgeI CNNG 6 cut(s) 81, 115, 132, 137, 155, 181
SnaBI TACGTA 1 cut(s) 181
Sse9I AATT 2 cut(s) 64, 202
TaiI ACGT 2 cut(s) 183, 196
TaqI TCGA 1 cut(s) 121
TasI AATT 2 cut(s) 64, 202
TfiI GAWTC 1 cut(s) 43
Tru1I TTAA 1 cut(s) 205
Tru9I TTAA 1 cut(s) 205
TspDTI ATGAA 1 cut(s) 159
XmnI GAANNNNTTC 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.