Rh2BG072000

Phospholipase D

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
5426706 .. 5426888
183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG072000.1

Sequence Viewer

Length: 183 bp
ATGGCACTCGTCTCCGAGCGCCTCCGCCACTGCTTTACTGCCTGCAACACCGTCAACTGCACCGGCTCCAGCTCTGACAATCCAGATGTCGGCGACCGAGCCGAGGACCGCAAGAATGACCACCACCGGAAAATCATCACCAGCGACTCTTACGCTGGAGACGACGGTATCGACCAGACCTAG

Protein Analysis

60

Amino Acids

6.6

Weight (kDa)

5.03

Isoelectric Point (pI)

39.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 25, 109
AfiI CCNNNNNNNGG 2 cut(s) 89, 103
AluBI AGCT 1 cut(s) 72
AluI AGCT 1 cut(s) 72
Alw26I GTCTC 2 cut(s) 16, 153
AspLEI GCGC 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 130
AvaII GGWCC 1 cut(s) 106
BaeI ACNNNNGTAYC 1 cut(s) 151
BcoDI GTCTC 2 cut(s) 16, 153
BfaI CTAG 1 cut(s) 181
BfoI RGCGCY 1 cut(s) 22
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 67
BpmI CTGGAG 2 cut(s) 52, 177
BsaJI CCNNGG 1 cut(s) 102
BsaWI WCCGGW 1 cut(s) 126
Bsc4I CCNNNNNNNGG 2 cut(s) 89, 103
Bse118I RCCGGY 1 cut(s) 62
BseDI CCNNGG 1 cut(s) 102
BseLI CCNNNNNNNGG 2 cut(s) 89, 103
BsgI GTGCAG 1 cut(s) 43
Bsh1285I CGRYCG 1 cut(s) 97
BsiEI CGRYCG 1 cut(s) 97
BsiSI CCGG 2 cut(s) 63, 127
BslI CCNNNNNNNGG 2 cut(s) 89, 103
BsmAI GTCTC 2 cut(s) 16, 153
BsmBI CGTCTC 2 cut(s) 16, 153
BspACI CCGC 2 cut(s) 25, 109
BspLI GGNNCC 1 cut(s) 67
BsrFI RCCGGY 1 cut(s) 62
BssAI RCCGGY 1 cut(s) 62
BssECI CCNNGG 1 cut(s) 102
Bst4CI ACNGT 2 cut(s) 52, 167
BstC8I GCNNGC 1 cut(s) 43
BstH2I RGCGCY 1 cut(s) 22
BstHHI GCGC 1 cut(s) 21
BstMAI GTCTC 2 cut(s) 16, 153
BstMCI CGRYCG 1 cut(s) 97
BtsI GCAGTG 1 cut(s) 28
BtsIMutI CAGTG 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 43
CfoI GCGC 1 cut(s) 21
Cfr10I RCCGGY 1 cut(s) 62
Cfr13I GGNCC 1 cut(s) 106
CviJI RGCY 3 cut(s) 66, 72, 101
CviKI_1 RGCY 3 cut(s) 66, 72, 101
EciI GGCGGA 1 cut(s) 14
Eco47I GGWCC 1 cut(s) 106
Esp3I CGTCTC 2 cut(s) 16, 153
FspBI CTAG 1 cut(s) 181
GlaI GCGC 1 cut(s) 20
GsuI CTGGAG 2 cut(s) 52, 177
HaeII RGCGCY 1 cut(s) 22
HapII CCGG 2 cut(s) 63, 127
HhaI GCGC 1 cut(s) 21
Hin6I GCGC 1 cut(s) 19
HinP1I GCGC 1 cut(s) 19
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HinfI GANTC 1 cut(s) 146
HpaII CCGG 2 cut(s) 63, 127
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 55
Hpy188I TCNGA 2 cut(s) 16, 76
Hpy188III TCNNGA 1 cut(s) 83
Hpy8I GTNNAC 1 cut(s) 55
Hpy99I CGWCG 1 cut(s) 167
HpyCH4III ACNGT 2 cut(s) 52, 167
HpyCH4V TGCA 2 cut(s) 45, 60
HspAI GCGC 1 cut(s) 19
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 7 cut(s) 55, 76, 82, 96, 140, 141, 154
MaeI CTAG 1 cut(s) 181
MlyI GAGTC 1 cut(s) 140
MnlI CCTC 2 cut(s) 32, 97
MspI CCGG 2 cut(s) 63, 127
NlaIV GGNNCC 1 cut(s) 67
NmeAIII GCCGAG 1 cut(s) 127
PcsI WCGNNNNNNNCGW 2 cut(s) 159, 168
PleI GAGTC 1 cut(s) 140
PpsI GAGTC 1 cut(s) 140
PspN4I GGNNCC 1 cut(s) 67
PspPI GGNCC 1 cut(s) 106
Sau96I GGNCC 1 cut(s) 106
SchI GAGTC 1 cut(s) 140
SetI ASST 2 cut(s) 74, 182
SinI GGWCC 1 cut(s) 106
SsiI CCGC 2 cut(s) 25, 109
SspMI CTAG 1 cut(s) 181
TaaI ACNGT 2 cut(s) 52, 167
TaqI TCGA 1 cut(s) 171
TaqII GACCGA 1 cut(s) 111
TscAI CASTG 1 cut(s) 35
TspRI CASTG 1 cut(s) 35
VpaK11BI GGWCC 1 cut(s) 106
XspI CTAG 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.