Rh2CG410200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
55873718 .. 55888236
14519 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG410200.1

Sequence Viewer

Length: 183 bp
ATGTGCCACCTACTGGGGGGAATGGATGCAAGTTCTTTAGAAGTTGAGGACAGGGATCATGTGGAAATGGTGCTTAAGTACATCGAGGACGATGGAGATCTCCGTCGTTGGAGCCTACCCGATATTAAAGGCCCTAATTATTGGACTTTTAGTCAATCACTCAAAGTTGAATTGCTTTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

7.02

Weight (kDa)

4.54

Isoelectric Point (pI)

58.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 13
AclWI GGATC 1 cut(s) 63
AfaI GTAC 1 cut(s) 80
AfiI CCNNNNNNNGG 2 cut(s) 13, 16
AflII CTTAAG 1 cut(s) 74
AgsI TTSAA 1 cut(s) 170
AhdI GACNNNNNGTC 1 cut(s) 150
AlwI GGATC 1 cut(s) 63
AoxI GGCC 1 cut(s) 130
AspS9I GGNCC 1 cut(s) 131
BccI CCATC 1 cut(s) 86
BfrI CTTAAG 1 cut(s) 74
BglII AGATCT 1 cut(s) 97
BmeRI GACNNNNNGTC 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 131
BmiI GGNNCC 1 cut(s) 113
BmrI ACTGGG 1 cut(s) 23
BmsI GCATC 1 cut(s) 16
BmuI ACTGGG 1 cut(s) 23
BsaBI GATNNNNATC 1 cut(s) 96
Bsc4I CCNNNNNNNGG 2 cut(s) 13, 16
Bse1I ACTGG 1 cut(s) 18
Bse8I GATNNNNATC 1 cut(s) 96
BseGI GGATG 1 cut(s) 31
BseJI GATNNNNATC 1 cut(s) 96
BseLI CCNNNNNNNGG 2 cut(s) 13, 16
BseNI ACTGG 1 cut(s) 18
BshFI GGCC 1 cut(s) 132
BslI CCNNNNNNNGG 2 cut(s) 13, 16
BsnI GGCC 1 cut(s) 132
Bsp143I GATC 2 cut(s) 55, 97
BspANI GGCC 1 cut(s) 132
BspLI GGNNCC 1 cut(s) 113
BspPI GGATC 1 cut(s) 63
BspTI CTTAAG 1 cut(s) 74
BsrI ACTGG 1 cut(s) 18
BssMI GATC 2 cut(s) 55, 97
BstAFI CTTAAG 1 cut(s) 74
BstF5I GGATG 1 cut(s) 31
BstKTI GATC 2 cut(s) 58, 100
BstMBI GATC 2 cut(s) 55, 97
BstX2I RGATCY 1 cut(s) 97
BstYI RGATCY 1 cut(s) 97
BsuRI GGCC 1 cut(s) 132
BtsCI GGATG 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 131
Csp6I GTAC 1 cut(s) 79
CviAII CATG 1 cut(s) 59
CviJI RGCY 2 cut(s) 114, 132
CviKI_1 RGCY 2 cut(s) 114, 132
CviQI GTAC 1 cut(s) 79
DpnI GATC 2 cut(s) 57, 99
DpnII GATC 2 cut(s) 55, 97
DriI GACNNNNNGTC 1 cut(s) 150
Eam1105I GACNNNNNGTC 1 cut(s) 150
EcoO109I RGGNCCY 1 cut(s) 131
FaeI CATG 1 cut(s) 62
FaiI YATR 1 cut(s) 60
FatI CATG 1 cut(s) 58
FokI GGATG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 132
Hin1II CATG 1 cut(s) 62
Hpy99I CGWCG 1 cut(s) 108
HpyCH4V TGCA 1 cut(s) 29
Hsp92II CATG 1 cut(s) 62
Kzo9I GATC 2 cut(s) 55, 97
LmnI GCTCC 1 cut(s) 111
LpnPI CCDG 1 cut(s) 37
LweI GCATC 1 cut(s) 16
MalI GATC 2 cut(s) 57, 99
MboI GATC 2 cut(s) 55, 97
MflI RGATCY 1 cut(s) 97
MluCI AATT 2 cut(s) 136, 170
MmeI TCCRAC 1 cut(s) 89
MnlI CCTC 2 cut(s) 40, 79
MseI TTAA 2 cut(s) 75, 126
MspCI CTTAAG 1 cut(s) 74
NdeII GATC 2 cut(s) 55, 97
NlaIII CATG 1 cut(s) 62
NlaIV GGNNCC 1 cut(s) 113
PflMI CCANNNNNTGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 113
PspPI GGNCC 1 cut(s) 131
PsuI RGATCY 1 cut(s) 97
RsaI GTAC 1 cut(s) 80
RsaNI GTAC 1 cut(s) 79
SaqAI TTAA 2 cut(s) 75, 126
Sau3AI GATC 2 cut(s) 55, 97
Sau96I GGNCC 1 cut(s) 131
SetI ASST 1 cut(s) 12
SfaNI GCATC 1 cut(s) 16
SgeI CNNG 6 cut(s) 26, 42, 64, 71, 97, 131
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 2 cut(s) 136, 170
TaqI TCGA 1 cut(s) 84
TasI AATT 2 cut(s) 136, 170
TatI WGTACW 1 cut(s) 78
Tru1I TTAA 2 cut(s) 75, 126
Tru9I TTAA 2 cut(s) 75, 126
TspGWI ACGGA 1 cut(s) 92
Van91I CCANNNNNTGG 1 cut(s) 13
Vha464I CTTAAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.