Rh7BG104700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
7812037 .. 7813482
1446 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG104700.1

Sequence Viewer

Length: 207 bp
ATGTCTAATCTGAAAATGGATGTACTAAATAAAGTCATGCATGGAATGGATGCAAGTTCTTTAGAAGTTGAGGACAGGGATCATGTGGAAATGGTGCTTAAGTACATCGAGGAGGATGGAGATCTCCGTCGTTGGAGCCTACCGGATATTAAACGCCGTAATTATTGGACTTTTAGTCAATCGCTCAAAGTTGAATTGCTTTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

8.18

Weight (kDa)

5.23

Isoelectric Point (pI)

86.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 87
AfaI GTAC 2 cut(s) 24, 104
AflII CTTAAG 1 cut(s) 98
AgsI TTSAA 1 cut(s) 194
AhdI GACNNNNNGTC 1 cut(s) 174
AlwI GGATC 1 cut(s) 87
BccI CCATC 1 cut(s) 110
BceAI ACGGC 1 cut(s) 141
BfrI CTTAAG 1 cut(s) 98
BglII AGATCT 1 cut(s) 121
BmeRI GACNNNNNGTC 1 cut(s) 174
BmiI GGNNCC 1 cut(s) 137
BmsI GCATC 1 cut(s) 40
BsaBI GATNNNNATC 1 cut(s) 120
BsaWI WCCGGW 1 cut(s) 142
Bse8I GATNNNNATC 1 cut(s) 120
BseGI GGATG 3 cut(s) 25, 55, 121
BseJI GATNNNNATC 1 cut(s) 120
BseRI GAGGAG 1 cut(s) 125
BsiSI CCGG 1 cut(s) 143
Bsp143I GATC 2 cut(s) 79, 121
BspLI GGNNCC 1 cut(s) 137
BspPI GGATC 1 cut(s) 87
BspTI CTTAAG 1 cut(s) 98
BssMI GATC 2 cut(s) 79, 121
BstAFI CTTAAG 1 cut(s) 98
BstF5I GGATG 3 cut(s) 25, 55, 121
BstKTI GATC 2 cut(s) 82, 124
BstMBI GATC 2 cut(s) 79, 121
BstX2I RGATCY 1 cut(s) 121
BstYI RGATCY 1 cut(s) 121
BtsCI GGATG 3 cut(s) 25, 55, 121
Csp6I GTAC 2 cut(s) 23, 103
CviAII CATG 3 cut(s) 37, 41, 83
CviJI RGCY 1 cut(s) 138
CviKI_1 RGCY 1 cut(s) 138
CviQI GTAC 2 cut(s) 23, 103
DpnI GATC 2 cut(s) 81, 123
DpnII GATC 2 cut(s) 79, 121
DriI GACNNNNNGTC 1 cut(s) 174
Eam1105I GACNNNNNGTC 1 cut(s) 174
EcoT22I ATGCAT 1 cut(s) 42
FaeI CATG 3 cut(s) 40, 44, 86
FaiI YATR 3 cut(s) 38, 42, 84
FatI CATG 3 cut(s) 36, 40, 82
FokI GGATG 3 cut(s) 32, 62, 128
HapII CCGG 1 cut(s) 143
Hin1II CATG 3 cut(s) 40, 44, 86
HpaII CCGG 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 12
Hpy99I CGWCG 1 cut(s) 132
HpyCH4V TGCA 2 cut(s) 40, 53
Hsp92II CATG 3 cut(s) 40, 44, 86
Kzo9I GATC 2 cut(s) 79, 121
LmnI GCTCC 1 cut(s) 135
LpnPI CCDG 2 cut(s) 61, 156
LweI GCATC 1 cut(s) 40
MalI GATC 2 cut(s) 81, 123
MboI GATC 2 cut(s) 79, 121
MflI RGATCY 1 cut(s) 121
MluCI AATT 2 cut(s) 160, 194
MmeI TCCRAC 1 cut(s) 113
MnlI CCTC 3 cut(s) 64, 103, 106
Mph1103I ATGCAT 1 cut(s) 42
MseI TTAA 2 cut(s) 99, 150
MspCI CTTAAG 1 cut(s) 98
MspI CCGG 1 cut(s) 143
NdeII GATC 2 cut(s) 79, 121
NlaIII CATG 3 cut(s) 40, 44, 86
NlaIV GGNNCC 1 cut(s) 137
NsiI ATGCAT 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 137
PsuI RGATCY 1 cut(s) 121
RsaI GTAC 2 cut(s) 24, 104
RsaNI GTAC 2 cut(s) 23, 103
SaqAI TTAA 2 cut(s) 99, 150
Sau3AI GATC 2 cut(s) 79, 121
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 7 cut(s) 49, 53, 66, 88, 95, 121, 155
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 2 cut(s) 160, 194
TaqI TCGA 1 cut(s) 108
TasI AATT 2 cut(s) 160, 194
TatI WGTACW 2 cut(s) 22, 102
Tru1I TTAA 2 cut(s) 99, 150
Tru9I TTAA 2 cut(s) 99, 150
TspGWI ACGGA 1 cut(s) 116
Vha464I CTTAAG 1 cut(s) 98
Zsp2I ATGCAT 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.