Rh4BG210300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
36627830 .. 36630501
2672 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG210300.1

Sequence Viewer

Length: 231 bp
ATGAAAATTAAGTTAAACACACTTAAAATGTTACTGCATCTGCATCTGCAACATGGAGAATTGGGTCTGGGGATGGTTGCGGTGGGATTGGGTGTTGTGACAGGTGGAGTAAGAGGTGGTGCAACAGCAAGTGGTGGTGGTGACCTTGAAACTGCTCTCAGCGAGTCCTTCAATATCAAAGAAGTTGGAGGATCATTGAATGACAAATGCGAGGAGGTTTTTGGACGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

7.82

Weight (kDa)

6.25

Isoelectric Point (pI)

24.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 80
AclWI GGATC 1 cut(s) 199
AgsI TTSAA 3 cut(s) 149, 172, 199
AlwI GGATC 1 cut(s) 199
AsuHPI GGTGA 1 cut(s) 152
BccI CCATC 1 cut(s) 67
BmsI GCATC 2 cut(s) 46, 52
BseGI GGATG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 172
BseRI GAGGAG 1 cut(s) 227
Bsp143I GATC 1 cut(s) 191
BspACI CCGC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 171
BspPI GGATC 1 cut(s) 199
BssMI GATC 1 cut(s) 191
Bst4CI ACNGT 1 cut(s) 228
BstDEI CTNAG 1 cut(s) 158
BstEII GGTNACC 1 cut(s) 140
BstF5I GGATG 1 cut(s) 78
BstKTI GATC 1 cut(s) 194
BstMBI GATC 1 cut(s) 191
BstPI GGTNACC 1 cut(s) 140
BtsCI GGATG 1 cut(s) 78
CviAII CATG 1 cut(s) 53
DdeI CTNAG 1 cut(s) 158
DpnI GATC 1 cut(s) 193
DpnII GATC 1 cut(s) 191
Eco91I GGTNACC 1 cut(s) 140
EcoO65I GGTNACC 1 cut(s) 140
FaeI CATG 1 cut(s) 56
FaiI YATR 1 cut(s) 54
FatI CATG 1 cut(s) 52
FokI GGATG 1 cut(s) 85
Hin1II CATG 1 cut(s) 56
HinfI GANTC 1 cut(s) 164
HphI GGTGA 1 cut(s) 152
HpyAV CCTTC 1 cut(s) 178
HpyCH4III ACNGT 1 cut(s) 228
HpyCH4V TGCA 4 cut(s) 37, 43, 49, 122
HpyF3I CTNAG 1 cut(s) 158
Hsp92II CATG 1 cut(s) 56
Kzo9I GATC 1 cut(s) 191
LpnPI CCDG 2 cut(s) 53, 87
LweI GCATC 2 cut(s) 46, 52
MaeIII GTNAC 3 cut(s) 30, 97, 140
MalI GATC 1 cut(s) 193
MboI GATC 1 cut(s) 191
MluCI AATT 2 cut(s) 6, 59
MlyI GAGTC 1 cut(s) 173
MmeI TCCRAC 1 cut(s) 166
MnlI CCTC 4 cut(s) 107, 182, 205, 208
MseI TTAA 3 cut(s) 9, 14, 24
NdeII GATC 1 cut(s) 191
NlaIII CATG 1 cut(s) 56
NmuCI GTSAC 2 cut(s) 97, 140
PleI GAGTC 1 cut(s) 172
PpsI GAGTC 1 cut(s) 172
PspEI GGTNACC 1 cut(s) 140
SaqAI TTAA 3 cut(s) 9, 14, 24
Sau3AI GATC 1 cut(s) 191
SchI GAGTC 1 cut(s) 173
SetI ASST 4 cut(s) 106, 118, 147, 219
SfaNI GCATC 2 cut(s) 46, 52
SgeI CNNG 7 cut(s) 65, 80, 114, 141, 158, 175, 223
Sse9I AATT 2 cut(s) 6, 59
SsiI CCGC 1 cut(s) 80
TaaI ACNGT 1 cut(s) 228
TasI AATT 2 cut(s) 6, 59
Tru1I TTAA 3 cut(s) 9, 14, 24
Tru9I TTAA 3 cut(s) 9, 14, 24
TseFI GTSAC 2 cut(s) 97, 140
Tsp45I GTSAC 2 cut(s) 97, 140
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.