Rh4CG323700

Sulfite oxidase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0002104
Physical Location & Seq
Forward (+)
58572244 .. 58572993
750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG323700.1

Sequence Viewer

Length: 321 bp
ATGTTTCCTCCTACAGCAAACTGGGAAAATATAGAATGGTCAACCAGAAGGCCTCGGATGGATTTTCCAGTTCAGGAAGAAAATACAGTAGATCCTGGAAAGATTGTAGTTCATGGATATGGAGTGTCTGGAGGCGGTCGGGGGATTGAGCGAGTAGATGCTGAAGCAGATCTCTCTCACAATACTGAAATCGTCACCAAAGCAGTTGATATCGCTGGAAATGTCCAACCCGAAAATGTGGGTGTCATCTGGAACCTGAGAGGAATACAAAACACGTCTTGGCACAGGGTCCGTGTTGAAGTCGAGGACCCTAATTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00920 ko01100 ko01120 map00920 map01100 map01120
Pfam Domains
Protein Families
Mo-co_dimer Oxidored_molyb

Protein Analysis

106

Amino Acids

11.91

Weight (kDa)

4.93

Isoelectric Point (pI)

36.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Mo-co_dimer PF03404 57 - 101 5.1e-10 Mo-co oxidoreductase dimerisation domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 135
AclWI GGATC 1 cut(s) 86
AcuI CTGAAG 1 cut(s) 183
AflIII ACRYGT 1 cut(s) 273
AgsI TTSAA 1 cut(s) 299
AjiI CACGTC 1 cut(s) 276
AjnI CCWGG 1 cut(s) 94
AlwI GGATC 1 cut(s) 86
AoxI GGCC 1 cut(s) 50
AspS9I GGNCC 2 cut(s) 289, 307
AsuHPI GGTGA 1 cut(s) 187
AvaII GGWCC 2 cut(s) 289, 307
BccI CCATC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 96
BfmI CTRYAG 1 cut(s) 12
BglII AGATCT 1 cut(s) 169
Bme1390I CCNGG 1 cut(s) 96
Bme18I GGWCC 2 cut(s) 289, 307
BmgBI CACGTC 1 cut(s) 276
BmgT120I GGNCC 2 cut(s) 289, 307
BmiI GGNNCC 3 cut(s) 254, 290, 309
BmrFI CCNGG 1 cut(s) 96
BmrI ACTGGG 1 cut(s) 31
BmsI GCATC 1 cut(s) 148
BmuI ACTGGG 1 cut(s) 31
BpmI CTGGAG 1 cut(s) 150
BsaJI CCNNGG 1 cut(s) 53
Bse1I ACTGG 2 cut(s) 26, 68
BseBI CCWGG 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 53
BseGI GGATG 1 cut(s) 63
BseMII CTCAG 1 cut(s) 248
BseNI ACTGG 2 cut(s) 26, 68
Bsh1285I CGRYCG 1 cut(s) 139
BshFI GGCC 1 cut(s) 52
BsiEI CGRYCG 1 cut(s) 139
BsnI GGCC 1 cut(s) 52
Bsp143I GATC 2 cut(s) 91, 169
BspACI CCGC 1 cut(s) 135
BspANI GGCC 1 cut(s) 52
BspCNI CTCAG 1 cut(s) 249
BspLI GGNNCC 3 cut(s) 254, 290, 309
BspPI GGATC 1 cut(s) 86
BsrI ACTGG 2 cut(s) 26, 68
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 2 cut(s) 91, 169
Bst2UI CCWGG 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 257
BstF5I GGATG 1 cut(s) 63
BstKTI GATC 2 cut(s) 94, 172
BstMBI GATC 2 cut(s) 91, 169
BstMCI CGRYCG 1 cut(s) 139
BstNI CCWGG 1 cut(s) 96
BstSCI CCNGG 1 cut(s) 94
BstSFI CTRYAG 1 cut(s) 12
BstX2I RGATCY 2 cut(s) 91, 169
BstYI RGATCY 2 cut(s) 91, 169
BsuRI GGCC 1 cut(s) 52
BtrI CACGTC 1 cut(s) 276
BtsCI GGATG 1 cut(s) 63
Cfr13I GGNCC 2 cut(s) 289, 307
CviAII CATG 1 cut(s) 113
CviJI RGCY 1 cut(s) 52
CviKI_1 RGCY 1 cut(s) 52
DdeI CTNAG 1 cut(s) 257
DpnI GATC 2 cut(s) 93, 171
DpnII GATC 2 cut(s) 91, 169
Eco147I AGGCCT 1 cut(s) 52
Eco32I GATATC 1 cut(s) 211
Eco47I GGWCC 2 cut(s) 289, 307
Eco57I CTGAAG 1 cut(s) 183
EcoO109I RGGNCCY 1 cut(s) 307
EcoRII CCWGG 1 cut(s) 94
EcoRV GATATC 1 cut(s) 211
FaeI CATG 1 cut(s) 116
FaiI YATR 3 cut(s) 32, 114, 120
FatI CATG 1 cut(s) 112
FokI GGATG 1 cut(s) 70
GsuI CTGGAG 1 cut(s) 150
HaeIII GGCC 1 cut(s) 52
Hin1II CATG 1 cut(s) 116
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HphI GGTGA 1 cut(s) 187
Hpy166II GTNNAC 1 cut(s) 42
Hpy188I TCNGA 2 cut(s) 57, 320
Hpy188III TCNNGA 3 cut(s) 74, 129, 250
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 1 cut(s) 42
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4IV ACGT 1 cut(s) 275
HpyF3I CTNAG 1 cut(s) 257
HpySE526I ACGT 1 cut(s) 275
Hsp92II CATG 1 cut(s) 116
Kzo9I GATC 2 cut(s) 91, 169
LweI GCATC 1 cut(s) 148
MaeII ACGT 1 cut(s) 275
MaeIII GTNAC 1 cut(s) 193
MalI GATC 2 cut(s) 93, 171
MboI GATC 2 cut(s) 91, 169
MboII GAAGA 1 cut(s) 89
MflI RGATCY 2 cut(s) 91, 169
MluCI AATT 1 cut(s) 313
MmeI TCCRAC 1 cut(s) 250
MnlI CCTC 5 cut(s) 18, 63, 125, 254, 298
MslI CAYNNNNRTG 1 cut(s) 117
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
NdeII GATC 2 cut(s) 91, 169
NlaIII CATG 1 cut(s) 116
NlaIV GGNNCC 3 cut(s) 254, 290, 309
NmuCI GTSAC 1 cut(s) 193
PceI AGGCCT 1 cut(s) 52
PfoI TCCNGGA 1 cut(s) 94
PpuMI RGGWCCY 1 cut(s) 307
Psp5II RGGWCCY 1 cut(s) 307
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
PspN4I GGNNCC 3 cut(s) 254, 290, 309
PspPI GGNCC 2 cut(s) 289, 307
PspPPI RGGWCCY 1 cut(s) 307
PsuI RGATCY 2 cut(s) 91, 169
RseI CAYNNNNRTG 1 cut(s) 117
Sau3AI GATC 2 cut(s) 91, 169
Sau96I GGNCC 2 cut(s) 289, 307
ScrFI CCNGG 1 cut(s) 96
SetI ASST 2 cut(s) 258, 278
SfaNI GCATC 1 cut(s) 148
SfcI CTRYAG 1 cut(s) 12
SinI GGWCC 2 cut(s) 289, 307
SmiMI CAYNNNNRTG 1 cut(s) 117
Sse9I AATT 1 cut(s) 313
SseBI AGGCCT 1 cut(s) 52
SsiI CCGC 1 cut(s) 135
StuI AGGCCT 1 cut(s) 52
StyD4I CCNGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 88
TaiI ACGT 1 cut(s) 278
TaqI TCGA 1 cut(s) 303
TasI AATT 1 cut(s) 313
TseFI GTSAC 1 cut(s) 193
Tsp45I GTSAC 1 cut(s) 193
TspDTI ATGAA 1 cut(s) 101
TspGWI ACGGA 1 cut(s) 281
VpaK11BI GGWCC 2 cut(s) 289, 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.