Rh5DG336500

reductase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
45160139 .. 45160926
788 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG336500.1

Sequence Viewer

Length: 309 bp
ATGCTCGTGGTGTTTATGAACACCGATTCTTCACCGATTAAGGGTTCGCTGGAAGACGAAGAGAACCTTGTTGGAGCAGTGAAGCAAGTTGATGTTGTGATTTGTGCTGTTCAGGTCAAACAGGTGCTCCATCAGAATCCAAGTTATCAAAAATGCTGGTTCCATCAAGGTTTCGATAATTCTGGCCTTCTTTTTTACCCTCTTAAAATTATGATCGACTTTGGGAAATTTGAGAATACTGTATTATCTAAATTCTTTTGTTCTGTTCTATGTAATTTGAGATTTACAAACTCAGTTAAGGAGTGGTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.68

Weight (kDa)

6.04

Isoelectric Point (pI)

23.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 227, 251
AfiI CCNNNNNNNGG 1 cut(s) 41
Alw21I GWGCWC 1 cut(s) 129
AoxI GGCC 1 cut(s) 184
ApoI RAATTY 2 cut(s) 227, 251
AsuHPI GGTGA 1 cut(s) 24
BauI CACGAG 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 60
Bbv12I GWGCWC 1 cut(s) 129
BccI CCATC 2 cut(s) 138, 171
BmiI GGNNCC 1 cut(s) 161
BpiI GAAGAC 1 cut(s) 60
BsaXI ACNNNNNCTCC 2 cut(s) 111, 141
Bsc4I CCNNNNNNNGG 1 cut(s) 41
BseLI CCNNNNNNNGG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 306
BshFI GGCC 1 cut(s) 186
BsiHKAI GWGCWC 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 41
BsnI GGCC 1 cut(s) 186
Bsp1286I GDGCHC 1 cut(s) 129
Bsp143I GATC 1 cut(s) 213
BspANI GGCC 1 cut(s) 186
BspCNI CTCAG 1 cut(s) 305
BspLI GGNNCC 1 cut(s) 161
BssMI GATC 1 cut(s) 213
BssSI CACGAG 1 cut(s) 5
Bst2BI CACGAG 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 241
Bst6I CTCTTC 1 cut(s) 54
BstDEI CTNAG 1 cut(s) 292
BstKTI GATC 1 cut(s) 216
BstMBI GATC 1 cut(s) 213
BstV2I GAAGAC 1 cut(s) 60
BsuRI GGCC 1 cut(s) 186
BtsI GCAGTG 1 cut(s) 84
BtsIMutI CAGTG 1 cut(s) 84
CviJI RGCY 1 cut(s) 186
CviKI_1 RGCY 1 cut(s) 186
DdeI CTNAG 1 cut(s) 292
DpnI GATC 1 cut(s) 215
DpnII GATC 1 cut(s) 213
Eam1104I CTCTTC 1 cut(s) 54
EarI CTCTTC 1 cut(s) 54
FaiI YATR 3 cut(s) 17, 212, 271
FalI AAGNNNNNCTT 2 cut(s) 51, 83
HaeIII GGCC 1 cut(s) 186
HinfI GANTC 2 cut(s) 26, 136
HphI GGTGA 1 cut(s) 24
Hpy188I TCNGA 1 cut(s) 135
HpyAV CCTTC 1 cut(s) 197
HpyCH4III ACNGT 1 cut(s) 241
HpyF3I CTNAG 1 cut(s) 292
Kzo9I GATC 1 cut(s) 213
LmnI GCTCC 2 cut(s) 74, 132
LpnPI CCDG 5 cut(s) 35, 98, 107, 142, 168
MalI GATC 1 cut(s) 215
MboI GATC 1 cut(s) 213
MboII GAAGA 3 cut(s) 21, 65, 71
MhlI GDGCHC 1 cut(s) 129
MluCI AATT 5 cut(s) 178, 207, 227, 251, 274
MmeI TCCRAC 1 cut(s) 52
MnlI CCTC 1 cut(s) 210
MseI TTAA 3 cut(s) 39, 204, 297
NdeII GATC 1 cut(s) 213
NlaIV GGNNCC 1 cut(s) 161
PfeI GAWTC 2 cut(s) 26, 136
PspN4I GGNNCC 1 cut(s) 161
SaqAI TTAA 3 cut(s) 39, 204, 297
Sau3AI GATC 1 cut(s) 213
SduI GDGCHC 1 cut(s) 129
SetI ASST 4 cut(s) 69, 117, 126, 172
Sse9I AATT 5 cut(s) 178, 207, 227, 251, 274
TaaI ACNGT 1 cut(s) 241
TaqI TCGA 2 cut(s) 174, 216
TasI AATT 5 cut(s) 178, 207, 227, 251, 274
TfiI GAWTC 2 cut(s) 26, 136
Tru1I TTAA 3 cut(s) 39, 204, 297
Tru9I TTAA 3 cut(s) 39, 204, 297
TscAI CASTG 1 cut(s) 84
TspDTI ATGAA 1 cut(s) 32
TspRI CASTG 1 cut(s) 84
XapI RAATTY 2 cut(s) 227, 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.