Rh6AG434300

ABC transporter B family member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0001951
Physical Location & Seq
Forward (+)
62408270 .. 62408922
653 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG434300.1

Sequence Viewer

Length: 222 bp
ATGGATAGGTGTAGCATCTTGGACGCGAACTGGTGGGACTGTGAGAGGCAGACAGCTCGTTTGCGATTGAAGTATCTTCAATCAGTTCTAAGGAAGGATATTGATTTTTTCGACACTGAAGCCAGAGACACTAACATCATTTTCCACATTTCGAGTGATGCTATACTAGTCCAAGATGCAATAGGTGACAAGACAGGCCACACTTTGCGTTACCTTTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko02010 ko04976 ko05206 ko05226 map02010 map04976 map05206 map05226
Pfam Domains
Protein Families
ABC_membrane ABC_tran

Protein Analysis

73

Amino Acids

8.58

Weight (kDa)

5.49

Isoelectric Point (pI)

42.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ABC_membrane PF00664 15 - 72 9.9e-07 ABC transporter transmembrane region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 26
AcuI CTGAAG 1 cut(s) 138
AgsI TTSAA 2 cut(s) 70, 80
AhlI ACTAGT 1 cut(s) 166
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
Alw26I GTCTC 1 cut(s) 120
AoxI GGCC 1 cut(s) 196
ArsI GACNNNNNNTTYG 2 cut(s) 43, 75
AsuHPI GGTGA 1 cut(s) 197
BcgI CGANNNNNNTGC 2 cut(s) 38, 72
BcoDI GTCTC 1 cut(s) 120
BcuI ACTAGT 1 cut(s) 166
BfaI CTAG 1 cut(s) 167
BmsI GCATC 3 cut(s) 24, 148, 166
Bse1I ACTGG 1 cut(s) 35
BseNI ACTGG 1 cut(s) 35
Bsh1236I CGCG 1 cut(s) 26
BshFI GGCC 1 cut(s) 198
BslFI GGGAC 1 cut(s) 50
BsmAI GTCTC 1 cut(s) 120
BsmFI GGGAC 1 cut(s) 50
BsnI GGCC 1 cut(s) 198
BspANI GGCC 1 cut(s) 198
BspFNI CGCG 1 cut(s) 26
BsrI ACTGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 41
BstDEI CTNAG 2 cut(s) 89, 219
BstFNI CGCG 1 cut(s) 26
BstMAI GTCTC 1 cut(s) 120
BstUI CGCG 1 cut(s) 26
BsuRI GGCC 1 cut(s) 198
BtsIMutI CAGTG 1 cut(s) 114
CseI GACGC 1 cut(s) 32
CviJI RGCY 3 cut(s) 56, 122, 198
CviKI_1 RGCY 3 cut(s) 56, 122, 198
DdeI CTNAG 2 cut(s) 89, 219
Eco57I CTGAAG 1 cut(s) 138
FaiI YATR 1 cut(s) 164
FaqI GGGAC 1 cut(s) 50
FspBI CTAG 1 cut(s) 167
HaeIII GGCC 1 cut(s) 198
HgaI GACGC 1 cut(s) 32
HphI GGTGA 1 cut(s) 197
HpyAV CCTTC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 41
HpyCH4V TGCA 1 cut(s) 179
HpyF3I CTNAG 2 cut(s) 89, 219
LpnPI CCDG 3 cut(s) 16, 136, 180
LweI GCATC 3 cut(s) 24, 148, 166
MaeI CTAG 1 cut(s) 167
MaeIII GTNAC 2 cut(s) 185, 209
MboII GAAGA 1 cut(s) 68
MnlI CCTC 1 cut(s) 39
MvnI CGCG 1 cut(s) 26
NmuCI GTSAC 1 cut(s) 185
SetI ASST 4 cut(s) 11, 58, 187, 216
SfaNI GCATC 3 cut(s) 24, 148, 166
SpeI ACTAGT 1 cut(s) 166
SspMI CTAG 1 cut(s) 167
TaaI ACNGT 1 cut(s) 41
TaqI TCGA 2 cut(s) 111, 152
TscAI CASTG 1 cut(s) 121
TseFI GTSAC 1 cut(s) 185
Tsp45I GTSAC 1 cut(s) 185
TspRI CASTG 1 cut(s) 121
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.