Rh6BG035900

Involved in the retrieval of endoplasmic reticulum membrane proteins from the early Golgi compartment

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0002176
Physical Location & Seq
Forward (+)
5880628 .. 5881575
948 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG035900.1

Sequence Viewer

Length: 291 bp
ATGGAATTTGGAATGCTTGGAATCTACGTCTTGAACCTCTTGATTGGGTTCTTCTCACCAAAGATGGACCGGGAAATTGAAGCTTTGGATGGGGCTTTACTGCCTACCAAAGGTTCTGATGAGTTCAGGCCTTTCATTATCCGCCTCTCGGAGTTCAAGTTATGGTATTTCATCACAAAGGCTTTCATTATTGCATTTATCATGACCTTTATCTTTGTGTTGGATGTGCCTGTTTTCTGGCCAATATTGAAATGCTACTGGATTATGCTATTTGTCCTCACAATGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0006810 GO:0006890 GO:0008150 GO:0016192 GO:0048193 GO:0051179 GO:0051234
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rer1

Protein Analysis

96

Amino Acids

11.37

Weight (kDa)

6.16

Isoelectric Point (pI)

34.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rer1 PF03248 5 - 96 2.1e-35 Rer1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 142
AcoI YGGCCR 1 cut(s) 239
AcsI RAATTY 1 cut(s) 5
AfiI CCNNNNNNNGG 2 cut(s) 110, 148
AgsI TTSAA 4 cut(s) 34, 80, 157, 250
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AoxI GGCC 2 cut(s) 128, 239
ApoI RAATTY 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 67
AsuC2I CCSGG 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 48
AvaII GGWCC 1 cut(s) 67
BalI TGGCCA 1 cut(s) 241
BccI CCATC 2 cut(s) 58, 83
BcnI CCSGG 1 cut(s) 71
Bme1390I CCNGG 1 cut(s) 71
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 67
BmrFI CCNGG 1 cut(s) 71
BpuMI CCSGG 1 cut(s) 71
BsaXI ACNNNNNCTCC 2 cut(s) 143, 173
Bsc4I CCNNNNNNNGG 2 cut(s) 110, 148
Bse1I ACTGG 1 cut(s) 263
BseGI GGATG 2 cut(s) 94, 229
BseLI CCNNNNNNNGG 2 cut(s) 110, 148
BseNI ACTGG 1 cut(s) 263
BshFI GGCC 2 cut(s) 130, 241
BsiSI CCGG 1 cut(s) 70
BslI CCNNNNNNNGG 2 cut(s) 110, 148
BsmI GAATGC 1 cut(s) 18
BsnI GGCC 2 cut(s) 130, 241
BspACI CCGC 1 cut(s) 142
BspANI GGCC 2 cut(s) 130, 241
BspHI TCATGA 1 cut(s) 201
BsrI ACTGG 1 cut(s) 263
BstENI CCTNNNNNAGG 1 cut(s) 108
BstF5I GGATG 2 cut(s) 94, 229
BstSCI CCNGG 1 cut(s) 69
BsuRI GGCC 2 cut(s) 130, 241
BtsCI GGATG 2 cut(s) 94, 229
CciI TCATGA 1 cut(s) 201
Cfr13I GGNCC 1 cut(s) 67
CviAII CATG 1 cut(s) 202
CviJI RGCY 5 cut(s) 83, 95, 130, 182, 241
CviKI_1 RGCY 5 cut(s) 83, 95, 130, 182, 241
EaeI YGGCCR 1 cut(s) 239
EciI GGCGGA 1 cut(s) 131
Eco147I AGGCCT 1 cut(s) 130
Eco47I GGWCC 1 cut(s) 67
EcoNI CCTNNNNNAGG 1 cut(s) 108
FaeI CATG 1 cut(s) 205
FaiI YATR 3 cut(s) 163, 203, 266
FatI CATG 1 cut(s) 201
FokI GGATG 2 cut(s) 101, 236
HaeIII GGCC 2 cut(s) 130, 241
HapII CCGG 1 cut(s) 70
Hin1II CATG 1 cut(s) 205
HindIII AAGCTT 1 cut(s) 81
HinfI GANTC 1 cut(s) 21
HpaII CCGG 1 cut(s) 70
HphI GGTGA 1 cut(s) 48
Hpy188I TCNGA 2 cut(s) 118, 151
Hpy188III TCNNGA 3 cut(s) 31, 40, 202
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 194
HpySE526I ACGT 1 cut(s) 27
Hsp92II CATG 1 cut(s) 205
LpnPI CCDG 5 cut(s) 83, 112, 223, 243, 244
MaeII ACGT 1 cut(s) 27
MboII GAAGA 1 cut(s) 43
MlsI TGGCCA 1 cut(s) 241
MluCI AATT 2 cut(s) 5, 75
MluNI TGGCCA 1 cut(s) 241
MmeI TCCRAC 1 cut(s) 201
MnlI CCTC 3 cut(s) 47, 155, 287
Mox20I TGGCCA 1 cut(s) 241
MscI TGGCCA 1 cut(s) 241
Msp20I TGGCCA 1 cut(s) 241
MspI CCGG 1 cut(s) 70
MspR9I CCNGG 1 cut(s) 71
Mva1269I GAATGC 1 cut(s) 18
NciI CCSGG 1 cut(s) 71
NlaIII CATG 1 cut(s) 205
PagI TCATGA 1 cut(s) 201
PceI AGGCCT 1 cut(s) 130
PctI GAATGC 1 cut(s) 18
PfeI GAWTC 1 cut(s) 21
PspPI GGNCC 1 cut(s) 67
Sau96I GGNCC 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 71
SetI ASST 5 cut(s) 30, 39, 85, 115, 209
SinI GGWCC 1 cut(s) 67
Sse9I AATT 2 cut(s) 5, 75
SseBI AGGCCT 1 cut(s) 130
SsiI CCGC 1 cut(s) 142
SspI AATATT 1 cut(s) 246
StuI AGGCCT 1 cut(s) 130
StyD4I CCNGG 1 cut(s) 69
TaiI ACGT 1 cut(s) 30
TasI AATT 2 cut(s) 5, 75
TfiI GAWTC 1 cut(s) 21
TspDTI ATGAA 3 cut(s) 124, 160, 175
VpaK11BI GGWCC 1 cut(s) 67
XagI CCTNNNNNAGG 1 cut(s) 108
XapI RAATTY 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.