Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6D

Orthogroup ID

OG0002651

Physical Location & Seq

Genomic Coordinates Reverse (-)

44940245 .. 44948717

Gene Structure 8473 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6DG258900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 219 bp

ATGGATCCCAAAATCAACTGGGCTTTAGAGCAGGCCTTCAATTTGAAGCTTGATTTCAGTGAGACTGGGGATGATTTTGTTGTTCTAAGACTGATGCTCAGGTATCTTGAACAAACAACTAATATTTTTGGTATGGCAAAAAAGGAGATGGACTACAGGGTTGAGTTGTTCAACAAGTTGAATGATGAAATTGAGGGAAGAAAGGCTAGGGACAGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

72

Amino Acids

8.56

Weight (kDa)

4.85

Isoelectric Point (pI)

28.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002651)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G29530 AT2G29530 AT2G29530
fragaria_vesca	FvH4_3g37430 FvH4_3g37430 FvH4_3g37440
malus_domestica	MD02G1203300.v1.1 MD02G1278800.v1.1 MD03G1080600.v1.1 MD03G1080700.v1.1 MD11G1085200.v1.1
prunus_persica	Prupe.6G065100_v2.0.a1 Prupe.6G065200_v2.0.a1
pyrus_communis	pycom03g06430 pycom03g06440 pycom11g07370
rosa_chinensis	RchiOBHm_Chr5g0067321 RchiOBHm_Chr5g0067331
rosa_laevigata	RLG00000018721 RLG00000035927
rosa_multiflora	Rmu_sc0000015.1_g000001 Rmu_sc0024489.1_g000001 Rmu_sc0034065.1_g000001 Rmu_ssc0000354.1_g000002
rosa_roxburghii	Rroxscaffold_1G00013750
rosa_rugosa	Rorug05G0384200 Rorug05G0384300 Rorug05G0384400
rosa_samantha	Rh5AG443600 Rh5AG443700 Rh5BG460600 Rh5BG460700 Rh5CG482900 Rh5CG483000 Rh5DG475700 Rh5DG475800 Rh6DG258900
rosa_wichuraiana	Rw2G027490 Rw5G041430 Rw5G041440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	12
AgsI	TTSAA	5 cut(s)	40, 46, 110, 172, 181
AluBI	AGCT	2 cut(s)	49, 216
AluI	AGCT	2 cut(s)	49, 216
Alw26I	GTCTC	1 cut(s)	56
AlwI	GGATC	1 cut(s)	12
AoxI	GGCC	1 cut(s)	33
BamHI	GGATCC	1 cut(s)	4
BccI	CCATC	1 cut(s)	142
BcoDI	GTCTC	1 cut(s)	56
BfaI	CTAG	2 cut(s)	207, 217
BfmI	CTRYAG	1 cut(s)	154
BmiI	GGNNCC	1 cut(s)	6
BmrI	ACTGGG	2 cut(s)	28, 75
BmsI	GCATC	1 cut(s)	84
BmuI	ACTGGG	2 cut(s)	28, 75
Bpu10I	CCTNAGC	1 cut(s)	98
Bse1I	ACTGG	2 cut(s)	23, 70
BseGI	GGATG	1 cut(s)	76
BseMII	CTCAG	1 cut(s)	112
BseNI	ACTGG	2 cut(s)	23, 70
BshFI	GGCC	1 cut(s)	35
BsmAI	GTCTC	1 cut(s)	56
BsnI	GGCC	1 cut(s)	35
Bsp143I	GATC	1 cut(s)	4
BspANI	GGCC	1 cut(s)	35
BspCNI	CTCAG	1 cut(s)	111
BspLI	GGNNCC	1 cut(s)	6
BspPI	GGATC	1 cut(s)	12
BsrI	ACTGG	2 cut(s)	23, 70
BssMI	GATC	1 cut(s)	4
BstC8I	GCNNGC	1 cut(s)	33
BstDEI	CTNAG	2 cut(s)	86, 98
BstF5I	GGATG	1 cut(s)	76
BstKTI	GATC	1 cut(s)	7
BstMAI	GTCTC	1 cut(s)	56
BstMBI	GATC	1 cut(s)	4
BstSFI	CTRYAG	1 cut(s)	154
BstX2I	RGATCY	1 cut(s)	4
BstYI	RGATCY	1 cut(s)	4
BsuRI	GGCC	1 cut(s)	35
BtsCI	GGATG	1 cut(s)	76
BtsIMutI	CAGTG	1 cut(s)	64
Cac8I	GCNNGC	1 cut(s)	33
CviJI	RGCY	5 cut(s)	23, 35, 49, 206, 216
CviKI_1	RGCY	5 cut(s)	23, 35, 49, 206, 216
DdeI	CTNAG	2 cut(s)	86, 98
DpnI	GATC	1 cut(s)	6
DpnII	GATC	1 cut(s)	4
Eco147I	AGGCCT	1 cut(s)	35
FaiI	YATR	1 cut(s)	134
FokI	GGATG	1 cut(s)	83
FspBI	CTAG	2 cut(s)	207, 217
HaeIII	GGCC	1 cut(s)	35
HindIII	AAGCTT	1 cut(s)	47
Hpy188III	TCNNGA	1 cut(s)	107
HpyAV	CCTTC	1 cut(s)	46
HpyF3I	CTNAG	2 cut(s)	86, 98
Kzo9I	GATC	1 cut(s)	4
LpnPI	CCDG	5 cut(s)	4, 17, 51, 85, 142
LweI	GCATC	1 cut(s)	84
MaeI	CTAG	2 cut(s)	207, 217
MalI	GATC	1 cut(s)	6
MboI	GATC	1 cut(s)	4
MboII	GAAGA	1 cut(s)	210
MflI	RGATCY	1 cut(s)	4
MluCI	AATT	2 cut(s)	40, 189
MnlI	CCTC	1 cut(s)	187
NdeII	GATC	1 cut(s)	4
NlaIV	GGNNCC	1 cut(s)	6
PceI	AGGCCT	1 cut(s)	35
PspN4I	GGNNCC	1 cut(s)	6
PsuI	RGATCY	1 cut(s)	4
Sau3AI	GATC	1 cut(s)	4
SetI	ASST	3 cut(s)	51, 104, 218
SfaNI	GCATC	1 cut(s)	84
SfcI	CTRYAG	1 cut(s)	154
SgeI	CNNG	8 cut(s)	31, 44, 62, 78, 112, 119, 169, 187
Sse9I	AATT	2 cut(s)	40, 189
SseBI	AGGCCT	1 cut(s)	35
SspI	AATATT	1 cut(s)	124
SspMI	CTAG	2 cut(s)	207, 217
StuI	AGGCCT	1 cut(s)	35
TasI	AATT	2 cut(s)	40, 189
TscAI	CASTG	1 cut(s)	64
TspDTI	ATGAA	1 cut(s)	201
TspRI	CASTG	1 cut(s)	64
XspI	CTAG	2 cut(s)	207, 217

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.