Rh7BG235100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0002271
Physical Location & Seq
Reverse (-)
20584082 .. 20585196
1115 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG235100.1

Sequence Viewer

Length: 378 bp
ATGAGTGGATACTCCTCATCAGCAGCAGTTCTGTTAGCAATGATGATGGTGATGATGACAATGTTCATCACCAAAACTGATTGCTTCAGCATCAACCAGACAATCACCGTCTCCTCGACTTGGTGCGATGGCCTCAACGACGACTTGTCGTGCCTAACTGGACAGACTGATTTGGATTCGGACGAGTTCATGCTGGACTCCGAATTCAGCAGAAGAATCTTGGCTGTAGATATAAGCTACGCTGCGAAATCTGGAAATGCTGGAAAATCTGCGGCATGTGACAGAAAGAATATGGCTCCGTGCCATCCTAGCACGGCAAACAACAACCCCCCATCAAACTGCAAGGATCCCACCAATCGTGCTTGCTTCCACTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

13.58

Weight (kDa)

4.84

Isoelectric Point (pI)

50.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 272
AclWI GGATC 2 cut(s) 341, 354
AcsI RAATTY 1 cut(s) 203
AcuI CTGAAG 1 cut(s) 70
AfiI CCNNNNNNNGG 1 cut(s) 120
AhdI GACNNNNNGTC 1 cut(s) 145
AluBI AGCT 1 cut(s) 237
AluI AGCT 1 cut(s) 237
Alw26I GTCTC 1 cut(s) 115
AlwI GGATC 2 cut(s) 341, 354
AoxI GGCC 1 cut(s) 130
ApeKI GCWGC 2 cut(s) 23, 242
ApoI RAATTY 1 cut(s) 203
AsuHPI GGTGA 3 cut(s) 61, 61, 97
BamHI GGATCC 1 cut(s) 346
BbvI GCAGC 2 cut(s) 35, 229
BccI CCATC 4 cut(s) 40, 122, 312, 340
BceAI ACGGC 1 cut(s) 330
BcoDI GTCTC 1 cut(s) 115
BfaI CTAG 1 cut(s) 309
BfmI CTRYAG 1 cut(s) 225
BisI GCNGC 3 cut(s) 24, 243, 273
BlsI GCNGC 3 cut(s) 25, 244, 274
BmeRI GACNNNNNGTC 1 cut(s) 145
BmiI GGNNCC 2 cut(s) 297, 348
BmsI GCATC 1 cut(s) 99
Bsc4I CCNNNNNNNGG 1 cut(s) 120
Bse1I ACTGG 1 cut(s) 163
Bse3DI GCAATG 1 cut(s) 45
BseGI GGATG 1 cut(s) 304
BseLI CCNNNNNNNGG 1 cut(s) 120
BseMI GCAATG 1 cut(s) 45
BseNI ACTGG 1 cut(s) 163
BseRI GAGGAG 2 cut(s) 4, 103
BseXI GCAGC 2 cut(s) 35, 229
BshFI GGCC 1 cut(s) 132
BslI CCNNNNNNNGG 1 cut(s) 120
BsmAI GTCTC 1 cut(s) 115
BsmBI CGTCTC 1 cut(s) 115
BsnI GGCC 1 cut(s) 132
Bsp143I GATC 1 cut(s) 346
BspACI CCGC 1 cut(s) 272
BspANI GGCC 1 cut(s) 132
BspLI GGNNCC 2 cut(s) 297, 348
BspPI GGATC 2 cut(s) 341, 354
BsrDI GCAATG 1 cut(s) 45
BsrI ACTGG 1 cut(s) 163
BssMI GATC 1 cut(s) 346
Bst4CI ACNGT 1 cut(s) 109
BstC8I GCNNGC 1 cut(s) 364
BstF5I GGATG 1 cut(s) 304
BstKTI GATC 1 cut(s) 349
BstMAI GTCTC 1 cut(s) 115
BstMBI GATC 1 cut(s) 346
BstMWI GCNNNNNNNGC 1 cut(s) 309
BstNSI RCATGY 1 cut(s) 279
BstSFI CTRYAG 1 cut(s) 225
BstV1I GCAGC 2 cut(s) 35, 229
BstX2I RGATCY 1 cut(s) 346
BstYI RGATCY 1 cut(s) 346
BsuRI GGCC 1 cut(s) 132
BtgZI GCGATG 1 cut(s) 141
BtsCI GGATG 1 cut(s) 304
Cac8I GCNNGC 1 cut(s) 364
CviAII CATG 2 cut(s) 190, 276
CviJI RGCY 4 cut(s) 132, 224, 237, 296
CviKI_1 RGCY 4 cut(s) 132, 224, 237, 296
DpnI GATC 1 cut(s) 348
DpnII GATC 1 cut(s) 346
DriI GACNNNNNGTC 1 cut(s) 145
Eam1105I GACNNNNNGTC 1 cut(s) 145
Eco57I CTGAAG 1 cut(s) 70
EcoRI GAATTC 1 cut(s) 203
Esp3I CGTCTC 1 cut(s) 115
FaeI CATG 2 cut(s) 193, 279
FaiI YATR 4 cut(s) 191, 233, 277, 293
FatI CATG 2 cut(s) 189, 275
Fnu4HI GCNGC 3 cut(s) 24, 243, 273
FokI GGATG 1 cut(s) 291
Fsp4HI GCNGC 3 cut(s) 24, 243, 273
FspBI CTAG 1 cut(s) 309
GluI GCNGC 3 cut(s) 24, 243, 273
HaeIII GGCC 1 cut(s) 132
Hin1II CATG 2 cut(s) 193, 279
HinfI GANTC 3 cut(s) 176, 197, 216
HphI GGTGA 3 cut(s) 61, 61, 97
Hpy188I TCNGA 2 cut(s) 181, 202
Hpy188III TCNNGA 1 cut(s) 252
Hpy99I CGWCG 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 342
HpyF10VI GCNNNNNNNGC 1 cut(s) 309
Hsp92II CATG 2 cut(s) 193, 279
Kzo9I GATC 1 cut(s) 346
LmnI GCTCC 1 cut(s) 301
LpnPI CCDG 5 cut(s) 110, 144, 179, 237, 246
Lsp1109I GCAGC 2 cut(s) 35, 229
LweI GCATC 1 cut(s) 99
MaeI CTAG 1 cut(s) 309
MaeIII GTNAC 1 cut(s) 278
MalI GATC 1 cut(s) 348
MboI GATC 1 cut(s) 346
MboII GAAGA 1 cut(s) 225
MflI RGATCY 1 cut(s) 346
MluCI AATT 1 cut(s) 203
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 3 cut(s) 25, 124, 143
MwoI GCNNNNNNNGC 1 cut(s) 309
NdeII GATC 1 cut(s) 346
NlaIII CATG 2 cut(s) 193, 279
NlaIV GGNNCC 2 cut(s) 297, 348
NmuCI GTSAC 1 cut(s) 278
NspI RCATGY 1 cut(s) 279
PfeI GAWTC 2 cut(s) 176, 216
PkrI GCNGC 3 cut(s) 25, 244, 274
PleI GAGTC 1 cut(s) 191
PpsI GAGTC 1 cut(s) 191
PspN4I GGNNCC 2 cut(s) 297, 348
PsuI RGATCY 1 cut(s) 346
SatI GCNGC 3 cut(s) 24, 243, 273
Sau3AI GATC 1 cut(s) 346
SchI GAGTC 1 cut(s) 191
SetI ASST 1 cut(s) 239
SfaNI GCATC 1 cut(s) 99
SfcI CTRYAG 1 cut(s) 225
Sse9I AATT 1 cut(s) 203
SsiI CCGC 1 cut(s) 272
SspMI CTAG 1 cut(s) 309
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 1 cut(s) 116
TasI AATT 1 cut(s) 203
TauI GCSGC 1 cut(s) 275
TfiI GAWTC 2 cut(s) 176, 216
TseFI GTSAC 1 cut(s) 278
TseI GCWGC 2 cut(s) 23, 242
Tsp45I GTSAC 1 cut(s) 278
TspDTI ATGAA 2 cut(s) 55, 178
TspGWI ACGGA 1 cut(s) 288
XapI RAATTY 1 cut(s) 203
XceI RCATGY 1 cut(s) 279
XspI CTAG 1 cut(s) 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.