Rh7BG348200

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
36322844 .. 36323146
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG348200.1

Sequence Viewer

Length: 303 bp
ATGGAGCCCAAGTGTGAGTTGGGAGCAATGACAAGTTCTCATGTTCTAGGAACTTCTAGTGAGAGTATCATCATCGACAGATTTAGTGATCTCCCAGATGAAATTGCTCATCACATTCTTAATTTCCTTCCACTGTGGCATCTTAATGAACCTCATCCGAGTGGGCGCAGTGTCCAAGAGATGCAGACAACTTTATCTATCACTTCCGTCTTTGATTATTGTTTCAGGTCATGTTTCAAACTGCACCAGGTCGAGAGTAAGGTTGATGAATTATTGGGACAGGTACTTGTTTCATCGTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.33

Weight (kDa)

5.14

Isoelectric Point (pI)

46.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 285
AgsI TTSAA 1 cut(s) 238
AjnI CCWGG 1 cut(s) 246
AspLEI GCGC 1 cut(s) 168
BanII GRGCYC 1 cut(s) 9
BciT130I CCWGG 1 cut(s) 248
BfaI CTAG 2 cut(s) 47, 57
Bme1390I CCNGG 1 cut(s) 248
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 248
BmsI GCATC 2 cut(s) 148, 171
BsaXI ACNNNNNCTCC 1 cut(s) 26
Bse3DI GCAATG 1 cut(s) 33
BseBI CCWGG 1 cut(s) 248
BseGI GGATG 1 cut(s) 154
BseMI GCAATG 1 cut(s) 33
BsgI GTGCAG 1 cut(s) 227
BslFI GGGAC 1 cut(s) 291
BsmFI GGGAC 1 cut(s) 291
Bsp1286I GDGCHC 1 cut(s) 9
Bsp143I GATC 1 cut(s) 88
BspLI GGNNCC 1 cut(s) 6
BsrDI GCAATG 1 cut(s) 33
BssMI GATC 1 cut(s) 88
Bst2UI CCWGG 1 cut(s) 248
Bst4CI ACNGT 1 cut(s) 135
BstF5I GGATG 1 cut(s) 154
BstHHI GCGC 1 cut(s) 168
BstKTI GATC 1 cut(s) 91
BstMBI GATC 1 cut(s) 88
BstNI CCWGG 1 cut(s) 248
BstSCI CCNGG 1 cut(s) 246
BtsCI GGATG 1 cut(s) 154
BtsI GCAGTG 1 cut(s) 175
BtsIMutI CAGTG 2 cut(s) 131, 175
CfoI GCGC 1 cut(s) 168
CsiI ACCWGGT 1 cut(s) 246
Csp6I GTAC 1 cut(s) 284
CviAII CATG 2 cut(s) 41, 231
CviJI RGCY 1 cut(s) 7
CviKI_1 RGCY 1 cut(s) 7
CviQI GTAC 1 cut(s) 284
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
Eco24I GRGCYC 1 cut(s) 9
EcoRII CCWGG 1 cut(s) 246
EcoT38I GRGCYC 1 cut(s) 9
FaeI CATG 2 cut(s) 44, 234
FaiI YATR 2 cut(s) 42, 232
FaqI GGGAC 1 cut(s) 291
FatI CATG 2 cut(s) 40, 230
FokI GGATG 1 cut(s) 141
FriOI GRGCYC 1 cut(s) 9
FspBI CTAG 2 cut(s) 47, 57
GlaI GCGC 1 cut(s) 167
HhaI GCGC 1 cut(s) 168
Hin1II CATG 2 cut(s) 44, 234
Hin6I GCGC 1 cut(s) 166
HinP1I GCGC 1 cut(s) 166
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 1 cut(s) 253
HpyAV CCTTC 1 cut(s) 137
HpyCH4III ACNGT 1 cut(s) 135
HpyCH4V TGCA 2 cut(s) 184, 244
Hsp92II CATG 2 cut(s) 44, 234
HspAI GCGC 1 cut(s) 166
Kzo9I GATC 1 cut(s) 88
LmnI GCTCC 2 cut(s) 4, 23
LpnPI CCDG 5 cut(s) 108, 211, 233, 260, 266
LweI GCATC 2 cut(s) 148, 171
MabI ACCWGGT 1 cut(s) 246
MaeI CTAG 2 cut(s) 47, 57
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MhlI GDGCHC 1 cut(s) 9
MluCI AATT 3 cut(s) 102, 121, 269
MnlI CCTC 1 cut(s) 162
MseI TTAA 2 cut(s) 120, 144
MslI CAYNNNNRTG 3 cut(s) 144, 159, 298
MspR9I CCNGG 1 cut(s) 248
MvaI CCWGG 1 cut(s) 248
NdeII GATC 1 cut(s) 88
NlaIII CATG 2 cut(s) 44, 234
NlaIV GGNNCC 1 cut(s) 6
Psp6I CCWGG 1 cut(s) 246
PspGI CCWGG 1 cut(s) 246
PspN4I GGNNCC 1 cut(s) 6
RsaI GTAC 1 cut(s) 285
RsaNI GTAC 1 cut(s) 284
RseI CAYNNNNRTG 3 cut(s) 144, 159, 298
SaqAI TTAA 2 cut(s) 120, 144
Sau3AI GATC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 248
SduI GDGCHC 1 cut(s) 9
SetI ASST 5 cut(s) 154, 230, 252, 264, 285
SexAI ACCWGGT 1 cut(s) 246
SfaNI GCATC 2 cut(s) 148, 171
SmiMI CAYNNNNRTG 3 cut(s) 144, 159, 298
Sse9I AATT 3 cut(s) 102, 121, 269
SspMI CTAG 2 cut(s) 47, 57
StyD4I CCNGG 1 cut(s) 246
TaaI ACNGT 1 cut(s) 135
TaqI TCGA 2 cut(s) 75, 252
TasI AATT 3 cut(s) 102, 121, 269
Tru1I TTAA 2 cut(s) 120, 144
Tru9I TTAA 2 cut(s) 120, 144
TscAI CASTG 2 cut(s) 138, 175
TspDTI ATGAA 4 cut(s) 114, 162, 282, 282
TspGWI ACGGA 1 cut(s) 196
TspRI CASTG 2 cut(s) 138, 175
XcmI CCANNNNNNNNNTGG 1 cut(s) 16
XspI CTAG 2 cut(s) 47, 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.