Rh7CG490000

dnaJ homolog subfamily C member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0002514
Physical Location & Seq
Reverse (-)
65853432 .. 65853626
195 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG490000.1

Sequence Viewer

Length: 195 bp
ATGAACAAGACTATAGACGAAGATCATTATAAAGTTCTTGGTTTGCCATCCGGCGAGGAAGGCTCTAAGCTCACAGAGAAACAGATTACAAAGGCTTACCACGCAAAAGCTTTGGTGTTGCACCCGGACAAGAGGCCTAAAAGTGATCTCCAAGCCAATACCGGCCAACTTCCAAAGGCTCAAAAGATCCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ RRM_1

Protein Analysis

64

Amino Acids

7.12

Weight (kDa)

9.3

Isoelectric Point (pI)

51.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 8 - 63 8.4e-09 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 30
AclWI GGATC 1 cut(s) 181
AcoI YGGCCR 1 cut(s) 163
AluBI AGCT 2 cut(s) 70, 110
AluI AGCT 2 cut(s) 70, 110
AlwI GGATC 1 cut(s) 181
AoxI GGCC 2 cut(s) 134, 163
AsuC2I CCSGG 1 cut(s) 125
BccI CCATC 1 cut(s) 55
BcnI CCSGG 1 cut(s) 125
BfmI CTRYAG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 125
BplI GAGNNNNNCTC 2 cut(s) 47, 79
BpuMI CCSGG 1 cut(s) 125
Bse118I RCCGGY 1 cut(s) 161
BseGI GGATG 1 cut(s) 47
BshFI GGCC 2 cut(s) 136, 165
BsiSI CCGG 3 cut(s) 51, 125, 162
BsnI GGCC 2 cut(s) 136, 165
Bsp143I GATC 3 cut(s) 22, 145, 186
BspANI GGCC 2 cut(s) 136, 165
BspPI GGATC 1 cut(s) 181
BsrFI RCCGGY 1 cut(s) 161
BssAI RCCGGY 1 cut(s) 161
BssMI GATC 3 cut(s) 22, 145, 186
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 47
BstKTI GATC 3 cut(s) 25, 148, 189
BstMBI GATC 3 cut(s) 22, 145, 186
BstMWI GCNNNNNNNGC 2 cut(s) 60, 101
BstSCI CCNGG 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 12
BstX2I RGATCY 1 cut(s) 186
BstYI RGATCY 1 cut(s) 186
BsuRI GGCC 2 cut(s) 136, 165
BtsCI GGATG 1 cut(s) 47
Cfr10I RCCGGY 1 cut(s) 161
CviJI RGCY 8 cut(s) 63, 70, 95, 110, 136, 155, 165, 179
CviKI_1 RGCY 8 cut(s) 63, 70, 95, 110, 136, 155, 165, 179
DdeI CTNAG 1 cut(s) 66
DpnI GATC 3 cut(s) 24, 147, 188
DpnII GATC 3 cut(s) 22, 145, 186
EaeI YGGCCR 1 cut(s) 163
Eco147I AGGCCT 1 cut(s) 136
FaiI YATR 3 cut(s) 14, 30, 193
FokI GGATG 1 cut(s) 34
HaeIII GGCC 2 cut(s) 136, 165
HapII CCGG 3 cut(s) 51, 125, 162
HindIII AAGCTT 1 cut(s) 108
HpaII CCGG 3 cut(s) 51, 125, 162
HpyAV CCTTC 1 cut(s) 53
HpyCH4V TGCA 1 cut(s) 121
HpyF10VI GCNNNNNNNGC 2 cut(s) 60, 101
HpyF3I CTNAG 1 cut(s) 66
Kzo9I GATC 3 cut(s) 22, 145, 186
LpnPI CCDG 3 cut(s) 64, 138, 175
MalI GATC 3 cut(s) 24, 147, 188
MboI GATC 3 cut(s) 22, 145, 186
MboII GAAGA 1 cut(s) 32
MflI RGATCY 1 cut(s) 186
MnlI CCTC 2 cut(s) 49, 126
MspI CCGG 3 cut(s) 51, 125, 162
MspR9I CCNGG 1 cut(s) 125
MwoI GCNNNNNNNGC 2 cut(s) 60, 101
NciI CCSGG 1 cut(s) 125
NdeII GATC 3 cut(s) 22, 145, 186
PceI AGGCCT 1 cut(s) 136
PsiI TTATAA 1 cut(s) 30
PsuI RGATCY 1 cut(s) 186
Sau3AI GATC 3 cut(s) 22, 145, 186
ScrFI CCNGG 1 cut(s) 125
SetI ASST 2 cut(s) 72, 112
SfcI CTRYAG 1 cut(s) 12
SseBI AGGCCT 1 cut(s) 136
StuI AGGCCT 1 cut(s) 136
StyD4I CCNGG 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.