Rw7G026850

Leucine-rich repeat receptor-like protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
OG0004586
Physical Location & Seq
Forward (+)
34209950 .. 34211124
1175 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G026850.1

Sequence Viewer

Length: 210 bp
ATGACACTATGGACTAACATGCCTCCAAGTTGGGGGACTCTGGATCCTTGTGAAGATGGTTGGGATGGCATTGGGTGTCACAACATGCGTGTGGTCTCTTTAACATTACCGAGTATGAATTTGACTGGCACACTCTCTGGAGATATTGAACAGTTATCTGAACTACAAGTTTTATATTTGGAAAATAGCCTTGAAACTCATAAACAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 Pkinase Pkinase_Tyr

Protein Analysis

69

Amino Acids

7.71

Weight (kDa)

4.2

Isoelectric Point (pI)

52.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 38, 51
AcsI RAATTY 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 32
AgsI TTSAA 2 cut(s) 149, 194
Alw26I GTCTC 1 cut(s) 100
AlwI GGATC 2 cut(s) 38, 51
ApoI RAATTY 1 cut(s) 118
BamHI GGATCC 1 cut(s) 43
BccI CCATC 2 cut(s) 50, 59
BcoDI GTCTC 1 cut(s) 100
BmiI GGNNCC 1 cut(s) 45
BpmI CTGGAG 1 cut(s) 159
BsaI GGTCTC 1 cut(s) 100
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse1I ACTGG 1 cut(s) 130
BseGI GGATG 1 cut(s) 70
BseLI CCNNNNNNNGG 1 cut(s) 32
BseNI ACTGG 1 cut(s) 130
BslFI GGGAC 1 cut(s) 49
BslI CCNNNNNNNGG 1 cut(s) 32
BsmAI GTCTC 1 cut(s) 100
BsmFI GGGAC 1 cut(s) 49
Bso31I GGTCTC 1 cut(s) 100
Bsp143I GATC 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 45
BspPI GGATC 2 cut(s) 38, 51
BspTNI GGTCTC 1 cut(s) 100
BsrI ACTGG 1 cut(s) 130
BssMI GATC 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 153
BstF5I GGATG 1 cut(s) 70
BstKTI GATC 1 cut(s) 46
BstMAI GTCTC 1 cut(s) 100
BstMBI GATC 1 cut(s) 43
BstNSI RCATGY 2 cut(s) 22, 88
BstX2I RGATCY 1 cut(s) 43
BstYI RGATCY 1 cut(s) 43
BtsCI GGATG 1 cut(s) 70
CviAII CATG 2 cut(s) 19, 85
CviJI RGCY 1 cut(s) 189
CviKI_1 RGCY 1 cut(s) 189
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eco31I GGTCTC 1 cut(s) 100
FaeI CATG 2 cut(s) 22, 88
FaiI YATR 6 cut(s) 10, 20, 86, 116, 175, 201
FaqI GGGAC 1 cut(s) 49
FatI CATG 2 cut(s) 18, 84
FokI GGATG 1 cut(s) 77
GsuI CTGGAG 1 cut(s) 159
Hin1II CATG 2 cut(s) 22, 88
HinfI GANTC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 2 cut(s) 41, 138
HpyCH4III ACNGT 1 cut(s) 153
Hsp92II CATG 2 cut(s) 22, 88
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 3 cut(s) 26, 111, 123
MaeIII GTNAC 1 cut(s) 77
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 1 cut(s) 65
MflI RGATCY 1 cut(s) 43
MluCI AATT 1 cut(s) 118
MlyI GAGTC 1 cut(s) 31
MnlI CCTC 1 cut(s) 33
MseI TTAA 1 cut(s) 101
MslI CAYNNNNRTG 1 cut(s) 89
NdeII GATC 1 cut(s) 43
NlaIII CATG 2 cut(s) 22, 88
NlaIV GGNNCC 1 cut(s) 45
NmuCI GTSAC 1 cut(s) 77
NspI RCATGY 2 cut(s) 22, 88
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
PspN4I GGNNCC 1 cut(s) 45
PsuI RGATCY 1 cut(s) 43
RseI CAYNNNNRTG 1 cut(s) 89
SaqAI TTAA 1 cut(s) 101
Sau3AI GATC 1 cut(s) 43
SchI GAGTC 1 cut(s) 31
SmiMI CAYNNNNRTG 1 cut(s) 89
Sse9I AATT 1 cut(s) 118
TaaI ACNGT 1 cut(s) 153
TasI AATT 1 cut(s) 118
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TseFI GTSAC 1 cut(s) 77
Tsp45I GTSAC 1 cut(s) 77
TspDTI ATGAA 1 cut(s) 131
XapI RAATTY 1 cut(s) 118
XceI RCATGY 2 cut(s) 22, 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.