AT1G19070

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
6584454 .. 6584705
252 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G19070.1

Sequence Viewer

Length: 252 bp
ATGGATAGGATCAATGGTCTATCAGATGAGATAATCTGCCACATTCTATCTTTCCTTCCGACAAAAGAGTCTGCTTTAACATCTGTCCTGTCAAAACGATGGCGTAATCTGTTTGCCTTGACACCGAATCTTCATTTAGTTGATGATGATCTAGAAGTGGGTGGTTGTGGACAAACCCTCATCGATTTTGTGGATAGAGTATTGGCTGTGTCAAGCAATTTGCCCATTAGGGAGTTTTCAATAAAATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.27

Weight (kDa)

5.13

Isoelectric Point (pI)

36.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 5 - 39 2.8e-08 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 67
AclWI GGATC 1 cut(s) 17
AgsI TTSAA 1 cut(s) 240
AlwI GGATC 1 cut(s) 17
BccI CCATC 1 cut(s) 93
BfaI CTAG 1 cut(s) 152
Bsa29I ATCGAT 1 cut(s) 183
BsaBI GATNNNNATC 1 cut(s) 147
Bse8I GATNNNNATC 1 cut(s) 147
BseCI ATCGAT 1 cut(s) 183
BseJI GATNNNNATC 1 cut(s) 147
BshVI ATCGAT 1 cut(s) 183
Bsp143I GATC 2 cut(s) 9, 148
BspDI ATCGAT 1 cut(s) 183
BspPI GGATC 1 cut(s) 17
BssMI GATC 2 cut(s) 9, 148
BstKTI GATC 2 cut(s) 12, 151
BstMBI GATC 2 cut(s) 9, 148
Bsu15I ATCGAT 1 cut(s) 183
BsuTUI ATCGAT 1 cut(s) 183
ClaI ATCGAT 1 cut(s) 183
CviJI RGCY 1 cut(s) 206
CviKI_1 RGCY 1 cut(s) 206
DpnI GATC 2 cut(s) 11, 150
DpnII GATC 2 cut(s) 9, 148
DrdI GACNNNNNNGTC 1 cut(s) 67
DseDI GACNNNNNNGTC 1 cut(s) 67
FspBI CTAG 1 cut(s) 152
HinfI GANTC 2 cut(s) 68, 127
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 2 cut(s) 25, 60
Hpy188III TCNNGA 1 cut(s) 152
Hpy8I GTNNAC 1 cut(s) 170
HpyAV CCTTC 1 cut(s) 65
Kzo9I GATC 2 cut(s) 9, 148
LpnPI CCDG 1 cut(s) 101
MaeI CTAG 1 cut(s) 152
MalI GATC 2 cut(s) 11, 150
MboI GATC 2 cut(s) 9, 148
MboII GAAGA 1 cut(s) 122
MluCI AATT 1 cut(s) 217
MlyI GAGTC 1 cut(s) 77
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 1 cut(s) 188
MseI TTAA 1 cut(s) 77
NdeII GATC 2 cut(s) 9, 148
PfeI GAWTC 1 cut(s) 127
PleI GAGTC 1 cut(s) 76
PpsI GAGTC 1 cut(s) 76
SaqAI TTAA 1 cut(s) 77
Sau3AI GATC 2 cut(s) 9, 148
SchI GAGTC 1 cut(s) 77
SgeI CNNG 4 cut(s) 100, 130, 164, 225
Sse9I AATT 1 cut(s) 217
SspMI CTAG 1 cut(s) 152
TaqI TCGA 1 cut(s) 183
TasI AATT 1 cut(s) 217
TfiI GAWTC 1 cut(s) 127
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TspDTI ATGAA 1 cut(s) 122
XbaI TCTAGA 1 cut(s) 151
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.