Rmu_sc0008328.1_g000003

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008328.1
Physical Location & Seq
Forward (+)
11204 .. 11944
741 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008328.1_g000003.1.cds

Sequence Viewer

Length: 276 bp
atgcccagaggggttgggatcgtggagttggatgacgtcatcctctggtggtccaacggtgggacagagcggcggcggaggaggccgacatcgacgaacatcaatttggaaatgggttcgaactccaactcaaagcgtggtgaagataggatcagtggcttacccgccacaattctttgtcatatcctttccttcctcgccacggttgatgctgtgaggaccagcattctatctcatcgactggaaaaaagttgtgggtgtttgttcccactttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.09

Weight (kDa)

9.15

Isoelectric Point (pI)

74.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 39
AccBSI CCGCTC 1 cut(s) 70
AciI CCGC 4 cut(s) 70, 73, 76, 165
AclWI GGATC 2 cut(s) 26, 158
AcyI GRCGYC 1 cut(s) 36
AfiI CCNNNNNNNGG 2 cut(s) 60, 202
AjuI GAANNNNNNNTTGG 2 cut(s) 89, 121
AlwI GGATC 2 cut(s) 26, 158
AoxI GGCC 1 cut(s) 83
AspS9I GGNCC 2 cut(s) 51, 219
AsuHPI GGTGA 1 cut(s) 152
AsuII TTCGAA 1 cut(s) 119
AvaII GGWCC 2 cut(s) 51, 219
BisI GCNGC 2 cut(s) 71, 74
BlsI GCNGC 2 cut(s) 72, 75
Bme18I GGWCC 2 cut(s) 51, 219
BmgT120I GGNCC 2 cut(s) 51, 219
BmsI GCATC 1 cut(s) 199
Bpu14I TTCGAA 1 cut(s) 119
BsaHI GRCGYC 1 cut(s) 36
BsaJI CCNNGG 1 cut(s) 201
Bsc4I CCNNNNNNNGG 2 cut(s) 60, 202
Bse1I ACTGG 1 cut(s) 246
BseDI CCNNGG 1 cut(s) 201
BseGI GGATG 2 cut(s) 37, 39
BseLI CCNNNNNNNGG 2 cut(s) 60, 202
BseNI ACTGG 1 cut(s) 246
BseRI GAGGAG 1 cut(s) 94
BshFI GGCC 1 cut(s) 85
BslFI GGGAC 1 cut(s) 76
BslI CCNNNNNNNGG 2 cut(s) 60, 202
BsmFI GGGAC 1 cut(s) 76
BsmI GAATGC 1 cut(s) 225
BsnI GGCC 1 cut(s) 85
Bsp119I TTCGAA 1 cut(s) 119
Bsp143I GATC 2 cut(s) 18, 150
BspACI CCGC 4 cut(s) 70, 73, 76, 165
BspANI GGCC 1 cut(s) 85
BspPI GGATC 2 cut(s) 26, 158
BspT104I TTCGAA 1 cut(s) 119
BsrBI CCGCTC 1 cut(s) 70
BsrI ACTGG 1 cut(s) 246
BssECI CCNNGG 1 cut(s) 201
BssMI GATC 2 cut(s) 18, 150
BssNI GRCGYC 1 cut(s) 36
Bst4CI ACNGT 2 cut(s) 59, 205
BstACI GRCGYC 1 cut(s) 36
BstBI TTCGAA 1 cut(s) 119
BstDSI CCRYGG 1 cut(s) 201
BstF5I GGATG 2 cut(s) 37, 39
BstKTI GATC 2 cut(s) 21, 153
BstMBI GATC 2 cut(s) 18, 150
BstMWI GCNNNNNNNGC 1 cut(s) 82
BsuRI GGCC 1 cut(s) 85
BtgI CCRYGG 1 cut(s) 201
BtsCI GGATG 2 cut(s) 37, 39
BtsIMutI CAGTG 1 cut(s) 160
Cfr13I GGNCC 2 cut(s) 51, 219
CviJI RGCY 2 cut(s) 85, 159
CviKI_1 RGCY 2 cut(s) 85, 159
DpnI GATC 2 cut(s) 20, 152
DpnII GATC 2 cut(s) 18, 150
EciI GGCGGA 1 cut(s) 91
Eco47I GGWCC 2 cut(s) 51, 219
FaiI YATR 1 cut(s) 183
FaqI GGGAC 1 cut(s) 76
FauI CCCGC 1 cut(s) 172
Fnu4HI GCNGC 2 cut(s) 71, 74
FokI GGATG 2 cut(s) 26, 44
Fsp4HI GCNGC 2 cut(s) 71, 74
GluI GCNGC 2 cut(s) 71, 74
HaeIII GGCC 1 cut(s) 85
Hin1I GRCGYC 1 cut(s) 36
HphI GGTGA 1 cut(s) 152
Hpy99I CGWCG 1 cut(s) 97
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 2 cut(s) 59, 205
HpyCH4IV ACGT 1 cut(s) 36
HpyF10VI GCNNNNNNNGC 1 cut(s) 82
HpySE526I ACGT 1 cut(s) 36
Hsp92I GRCGYC 1 cut(s) 36
Kzo9I GATC 2 cut(s) 18, 150
LpnPI CCDG 4 cut(s) 19, 31, 227, 235
LweI GCATC 1 cut(s) 199
MaeII ACGT 1 cut(s) 36
MalI GATC 2 cut(s) 20, 152
MbiI CCGCTC 1 cut(s) 70
MboI GATC 2 cut(s) 18, 150
MboII GAAGA 1 cut(s) 155
MluCI AATT 2 cut(s) 103, 171
MmeI TCCRAC 3 cut(s) 9, 78, 150
MnlI CCTC 5 cut(s) 53, 72, 75, 206, 210
Mva1269I GAATGC 1 cut(s) 225
MwoI GCNNNNNNNGC 1 cut(s) 82
NdeII GATC 2 cut(s) 18, 150
NspV TTCGAA 1 cut(s) 119
PctI GAATGC 1 cut(s) 225
PkrI GCNGC 2 cut(s) 72, 75
PspPI GGNCC 2 cut(s) 51, 219
SatI GCNGC 2 cut(s) 71, 74
Sau3AI GATC 2 cut(s) 18, 150
Sau96I GGNCC 2 cut(s) 51, 219
SetI ASST 1 cut(s) 39
SfaNI GCATC 1 cut(s) 199
SfuI TTCGAA 1 cut(s) 119
SgeI CNNG 9 cut(s) 18, 34, 58, 149, 176, 209, 214, 234, 254
SinI GGWCC 2 cut(s) 51, 219
Sse9I AATT 2 cut(s) 103, 171
SsiI CCGC 4 cut(s) 70, 73, 76, 165
TaaI ACNGT 2 cut(s) 59, 205
TaiI ACGT 1 cut(s) 39
TaqI TCGA 3 cut(s) 92, 119, 238
TasI AATT 2 cut(s) 103, 171
TauI GCSGC 2 cut(s) 73, 76
TscAI CASTG 1 cut(s) 160
TspRI CASTG 1 cut(s) 160
VpaK11BI GGWCC 2 cut(s) 51, 219
ZraI GACGTC 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.