RchiOBHm_Chr4g0417371

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0003191
Physical Location & Seq
Reverse (-)
42604635 .. 42604880
246 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38746

Sequence Viewer

Length: 246 bp
ATGGATTCGAAATCAAAACGTCCAGACGGAGCTGAAGATAGGATCAGCCAATTACCGGACGATATTCTTGTTCATATACTATCCTATATTCCGACGGTCTATTCTGTCCGAACCACGGTTTTGTCTAAAAGATGGAACAACTTATGGACCTTCGTCCCCACCCTAGACTTGGACCAACAAGATTATTCCGAAGAACACGGTCATCGAACTCGGAATAGTTTTGATAAATTTGCCAAAGTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD

Protein Analysis

81

Amino Acids

9.48

Weight (kDa)

6.25

Isoelectric Point (pI)

58.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 15 - 50 2.3e-09 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 50
AcsI RAATTY 1 cut(s) 227
AcuI CTGAAG 1 cut(s) 54
AfiI CCNNNNNNNGG 3 cut(s) 55, 115, 169
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
AlwI GGATC 1 cut(s) 50
ApoI RAATTY 1 cut(s) 227
AspS9I GGNCC 2 cut(s) 147, 172
AsuII TTCGAA 1 cut(s) 8
AvaII GGWCC 2 cut(s) 147, 172
BccI CCATC 1 cut(s) 126
BfaI CTAG 1 cut(s) 164
Bme18I GGWCC 2 cut(s) 147, 172
BmgT120I GGNCC 2 cut(s) 147, 172
BoxI GACNNNNGTC 1 cut(s) 152
Bpu14I TTCGAA 1 cut(s) 8
BsaJI CCNNGG 1 cut(s) 114
BsaWI WCCGGW 1 cut(s) 55
Bsc4I CCNNNNNNNGG 3 cut(s) 55, 115, 169
BseDI CCNNGG 1 cut(s) 114
BseLI CCNNNNNNNGG 3 cut(s) 55, 115, 169
BsiSI CCGG 1 cut(s) 56
BslFI GGGAC 1 cut(s) 140
BslI CCNNNNNNNGG 3 cut(s) 55, 115, 169
BsmFI GGGAC 1 cut(s) 140
Bsp119I TTCGAA 1 cut(s) 8
Bsp143I GATC 1 cut(s) 42
BspPI GGATC 1 cut(s) 50
BspT104I TTCGAA 1 cut(s) 8
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 1 cut(s) 42
Bst4CI ACNGT 3 cut(s) 97, 118, 200
BstBI TTCGAA 1 cut(s) 8
BstDSI CCRYGG 1 cut(s) 114
BstKTI GATC 1 cut(s) 45
BstMBI GATC 1 cut(s) 42
BstPAI GACNNNNGTC 1 cut(s) 152
BtgI CCRYGG 1 cut(s) 114
Cfr13I GGNCC 2 cut(s) 147, 172
CviJI RGCY 2 cut(s) 32, 48
CviKI_1 RGCY 2 cut(s) 32, 48
DpnI GATC 1 cut(s) 44
DpnII GATC 1 cut(s) 42
Eco47I GGWCC 2 cut(s) 147, 172
Eco57I CTGAAG 1 cut(s) 54
FaiI YATR 4 cut(s) 75, 77, 87, 145
FaqI GGGAC 1 cut(s) 140
FspBI CTAG 1 cut(s) 164
HapII CCGG 1 cut(s) 56
HinfI GANTC 1 cut(s) 5
HpaII CCGG 1 cut(s) 56
Hpy188I TCNGA 4 cut(s) 93, 110, 190, 213
Hpy188III TCNNGA 1 cut(s) 23
Hpy99I CGWCG 1 cut(s) 97
HpyAV CCTTC 1 cut(s) 160
HpyCH4III ACNGT 3 cut(s) 97, 118, 200
HpyCH4IV ACGT 1 cut(s) 19
HpySE526I ACGT 1 cut(s) 19
Kzo9I GATC 1 cut(s) 42
LmnI GCTCC 1 cut(s) 29
LpnPI CCDG 2 cut(s) 36, 69
MaeI CTAG 1 cut(s) 164
MaeII ACGT 1 cut(s) 19
MalI GATC 1 cut(s) 44
MboI GATC 1 cut(s) 42
MboII GAAGA 2 cut(s) 47, 203
MluCI AATT 2 cut(s) 50, 227
MmeI TCCRAC 1 cut(s) 116
MspI CCGG 1 cut(s) 56
NdeII GATC 1 cut(s) 42
NspV TTCGAA 1 cut(s) 8
PfeI GAWTC 1 cut(s) 5
PshAI GACNNNNGTC 1 cut(s) 152
PspPI GGNCC 2 cut(s) 147, 172
Sau3AI GATC 1 cut(s) 42
Sau96I GGNCC 2 cut(s) 147, 172
SetI ASST 3 cut(s) 22, 34, 152
SfuI TTCGAA 1 cut(s) 8
SgeI CNNG 9 cut(s) 35, 68, 80, 127, 176, 181, 191, 209, 222
SinI GGWCC 2 cut(s) 147, 172
Sse9I AATT 2 cut(s) 50, 227
SspMI CTAG 1 cut(s) 164
TaaI ACNGT 3 cut(s) 97, 118, 200
TaiI ACGT 1 cut(s) 22
TaqI TCGA 2 cut(s) 8, 205
TasI AATT 2 cut(s) 50, 227
TfiI GAWTC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 62
TspGWI ACGGA 1 cut(s) 42
VpaK11BI GGWCC 2 cut(s) 147, 172
XapI RAATTY 1 cut(s) 227
XcmI CCANNNNNNNNNTGG 1 cut(s) 166
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.