Rh5AG211200

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
24933628 .. 24933910
283 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG211200.1

Sequence Viewer

Length: 228 bp
ATGAACATCAATTTGGAAATGGGTTCAAACTCCAACTCAAAGCGTGGTGAAGATAGGATCGGTGGCTTACCCGACGCAATTCTTTGTCATATCCTTTCCTTCCTCGCCACGGTTGATGCTGTGAGGACCAACATTCTATCTCATCGATGGGAAAAGTTGTGGGTGTCTGTTCCCACTTTAGACCTACGTGATGACGGTTTTGATCAAGAAAAAGAAGAGTATATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.54

Weight (kDa)

4.77

Isoelectric Point (pI)

64.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 65
AfiI CCNNNNNNNGG 1 cut(s) 109
AgsI TTSAA 1 cut(s) 27
AjuI GAANNNNNNNTTGG 1 cut(s) 28
AlwI GGATC 1 cut(s) 65
AspS9I GGNCC 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 59
AvaII GGWCC 1 cut(s) 126
BccI CCATC 1 cut(s) 141
BclI TGATCA 1 cut(s) 202
Bme18I GGWCC 1 cut(s) 126
BmgT120I GGNCC 1 cut(s) 126
BmsI GCATC 1 cut(s) 106
Bsa29I ATCGAT 1 cut(s) 145
BsaAI YACGTR 1 cut(s) 188
BsaJI CCNNGG 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 109
BseCI ATCGAT 1 cut(s) 145
BseDI CCNNGG 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 109
BshVI ATCGAT 1 cut(s) 145
BslI CCNNNNNNNGG 1 cut(s) 109
Bsp143I GATC 2 cut(s) 57, 202
BspDI ATCGAT 1 cut(s) 145
BspPI GGATC 1 cut(s) 65
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 2 cut(s) 57, 202
Bst4CI ACNGT 2 cut(s) 112, 197
Bst6I CTCTTC 1 cut(s) 210
BstBAI YACGTR 1 cut(s) 188
BstDSI CCRYGG 1 cut(s) 108
BstKTI GATC 2 cut(s) 60, 205
BstMBI GATC 2 cut(s) 57, 202
Bsu15I ATCGAT 1 cut(s) 145
BsuTUI ATCGAT 1 cut(s) 145
BtgI CCRYGG 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 126
ClaI ATCGAT 1 cut(s) 145
CseI GACGC 1 cut(s) 83
CviJI RGCY 1 cut(s) 66
CviKI_1 RGCY 1 cut(s) 66
DpnI GATC 2 cut(s) 59, 204
DpnII GATC 2 cut(s) 57, 202
Eam1104I CTCTTC 1 cut(s) 210
EarI CTCTTC 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 126
FaiI YATR 4 cut(s) 90, 222, 224, 226
FbaI TGATCA 1 cut(s) 202
HgaI GACGC 1 cut(s) 83
HphI GGTGA 1 cut(s) 59
Hpy188III TCNNGA 1 cut(s) 206
Hpy99I CGWCG 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 109
HpyCH4III ACNGT 2 cut(s) 112, 197
HpyCH4IV ACGT 1 cut(s) 187
HpySE526I ACGT 1 cut(s) 187
Ksp22I TGATCA 1 cut(s) 202
Kzo9I GATC 2 cut(s) 57, 202
LweI GCATC 1 cut(s) 106
MaeII ACGT 1 cut(s) 187
MalI GATC 2 cut(s) 59, 204
MboI GATC 2 cut(s) 57, 202
MboII GAAGA 2 cut(s) 62, 227
MluCI AATT 2 cut(s) 10, 78
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 2 cut(s) 113, 117
NdeII GATC 2 cut(s) 57, 202
Ppu21I YACGTR 1 cut(s) 188
PspPI GGNCC 1 cut(s) 126
Sau3AI GATC 2 cut(s) 57, 202
Sau96I GGNCC 1 cut(s) 126
SetI ASST 2 cut(s) 186, 190
SfaNI GCATC 1 cut(s) 106
SgeI CNNG 6 cut(s) 56, 83, 116, 121, 200, 218
SinI GGWCC 1 cut(s) 126
Sse9I AATT 2 cut(s) 10, 78
TaaI ACNGT 2 cut(s) 112, 197
TaiI ACGT 1 cut(s) 190
TaqI TCGA 1 cut(s) 145
TasI AATT 2 cut(s) 10, 78
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.