Rh5DG198300

LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0003191
Physical Location & Seq
Reverse (-)
22092661 .. 22092954
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG198300.1

Sequence Viewer

Length: 294 bp
ATGGTTTTGAAGTCAAAGCGTCAAGTAGTTGCAAAAGATAGGATCGGTGCATTACCGGATGCACTTATTTGTCATATACTTTCATTCCTTCAAACTAAATATGCTGTGAGGACTACCATTTTGTCCACCAGATGGAAGGACACATGGACCTCGGTTCCCAATTTAAACTTCGATAACACAGAAGATTTTATTACTGTCAAGAAAGGATGCTATAGCTATGATCGATTCAAGACTTTTGTCGACCGTCACTACTACAATATGGGCCATAGAGCACCGATCTGGGCAACTATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD LRR_2

Protein Analysis

97

Amino Acids

11.39

Weight (kDa)

9.69

Isoelectric Point (pI)

42.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 18 - 54 2.7e-07 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 132
AccI GTMKAC 1 cut(s) 240
AclWI GGATC 1 cut(s) 50
AfiI CCNNNNNNNGG 1 cut(s) 132
AgsI TTSAA 3 cut(s) 10, 92, 229
AjuI GAANNNNNNNTTGG 2 cut(s) 152, 184
AluBI AGCT 1 cut(s) 216
AluI AGCT 1 cut(s) 216
Alw21I GWGCWC 1 cut(s) 274
AlwI GGATC 1 cut(s) 50
AoxI GGCC 1 cut(s) 262
ArsI GACNNNNNNTTYG 2 cut(s) 103, 135
AspS9I GGNCC 2 cut(s) 147, 262
AvaII GGWCC 1 cut(s) 147
Bbv12I GWGCWC 1 cut(s) 274
BccI CCATC 1 cut(s) 126
BfmI CTRYAG 1 cut(s) 211
Bme18I GGWCC 1 cut(s) 147
BmgT120I GGNCC 2 cut(s) 147, 262
BmiI GGNNCC 1 cut(s) 156
BmsI GCATC 2 cut(s) 49, 197
BoxI GACNNNNGTC 1 cut(s) 236
Bsa29I ATCGAT 1 cut(s) 223
BsaJI CCNNGG 1 cut(s) 150
BsaWI WCCGGW 1 cut(s) 55
Bsc4I CCNNNNNNNGG 1 cut(s) 132
BseCI ATCGAT 1 cut(s) 223
BseDI CCNNGG 1 cut(s) 150
BseGI GGATG 2 cut(s) 64, 212
BseLI CCNNNNNNNGG 1 cut(s) 132
Bsh1285I CGRYCG 1 cut(s) 244
BshFI GGCC 1 cut(s) 264
BshVI ATCGAT 1 cut(s) 223
BsiEI CGRYCG 1 cut(s) 244
BsiHKAI GWGCWC 1 cut(s) 274
BsiSI CCGG 1 cut(s) 56
BslI CCNNNNNNNGG 1 cut(s) 132
BsnI GGCC 1 cut(s) 264
Bsp1286I GDGCHC 1 cut(s) 274
Bsp143I GATC 3 cut(s) 42, 220, 276
BspANI GGCC 1 cut(s) 264
BspDI ATCGAT 1 cut(s) 223
BspLI GGNNCC 1 cut(s) 156
BspPI GGATC 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 150
BssMI GATC 3 cut(s) 42, 220, 276
Bst4CI ACNGT 2 cut(s) 196, 245
BstF5I GGATG 2 cut(s) 64, 212
BstKTI GATC 3 cut(s) 45, 223, 279
BstMBI GATC 3 cut(s) 42, 220, 276
BstMCI CGRYCG 1 cut(s) 244
BstPAI GACNNNNGTC 1 cut(s) 236
BstSFI CTRYAG 1 cut(s) 211
Bsu15I ATCGAT 1 cut(s) 223
BsuRI GGCC 1 cut(s) 264
BsuTUI ATCGAT 1 cut(s) 223
BtsCI GGATG 2 cut(s) 64, 212
Cfr13I GGNCC 2 cut(s) 147, 262
ClaI ATCGAT 1 cut(s) 223
CseI GACGC 1 cut(s) 8
CviAII CATG 1 cut(s) 144
CviJI RGCY 2 cut(s) 216, 264
CviKI_1 RGCY 2 cut(s) 216, 264
DpnI GATC 3 cut(s) 44, 222, 278
DpnII GATC 3 cut(s) 42, 220, 276
DraI TTTAAA 1 cut(s) 165
Eco47I GGWCC 1 cut(s) 147
FaeI CATG 1 cut(s) 147
FaiI YATR 8 cut(s) 75, 77, 102, 145, 213, 219, 260, 267
FatI CATG 1 cut(s) 143
FblI GTMKAC 1 cut(s) 240
FokI GGATG 2 cut(s) 71, 219
HaeIII GGCC 1 cut(s) 264
HapII CCGG 1 cut(s) 56
HgaI GACGC 1 cut(s) 8
Hin1II CATG 1 cut(s) 147
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HinfI GANTC 1 cut(s) 225
HpaII CCGG 1 cut(s) 56
Hpy166II GTNNAC 2 cut(s) 126, 241
Hpy188III TCNNGA 2 cut(s) 199, 229
Hpy8I GTNNAC 2 cut(s) 126, 241
HpyAV CCTTC 2 cut(s) 98, 130
HpyCH4III ACNGT 2 cut(s) 196, 245
HpyCH4V TGCA 3 cut(s) 32, 50, 62
Hsp92II CATG 1 cut(s) 147
Kzo9I GATC 3 cut(s) 42, 220, 276
LpnPI CCDG 3 cut(s) 69, 142, 265
LweI GCATC 2 cut(s) 49, 197
MaeIII GTNAC 1 cut(s) 245
MalI GATC 3 cut(s) 44, 222, 278
MboI GATC 3 cut(s) 42, 220, 276
MboII GAAGA 1 cut(s) 194
MhlI GDGCHC 1 cut(s) 274
MluCI AATT 1 cut(s) 160
MnlI CCTC 2 cut(s) 102, 160
MseI TTAA 2 cut(s) 164, 292
MspI CCGG 1 cut(s) 56
NdeII GATC 3 cut(s) 42, 220, 276
NlaIII CATG 1 cut(s) 147
NlaIV GGNNCC 1 cut(s) 156
NmuCI GTSAC 1 cut(s) 245
PfeI GAWTC 1 cut(s) 225
PflMI CCANNNNNTGG 1 cut(s) 132
PshAI GACNNNNGTC 1 cut(s) 236
PspN4I GGNNCC 1 cut(s) 156
PspPI GGNCC 2 cut(s) 147, 262
SalI GTCGAC 1 cut(s) 239
SaqAI TTAA 2 cut(s) 164, 292
Sau3AI GATC 3 cut(s) 42, 220, 276
Sau96I GGNCC 2 cut(s) 147, 262
SduI GDGCHC 1 cut(s) 274
SetI ASST 2 cut(s) 152, 218
SfaNI GCATC 2 cut(s) 49, 197
SfcI CTRYAG 1 cut(s) 211
SgeI CNNG 7 cut(s) 35, 68, 141, 156, 163, 211, 241
SinI GGWCC 1 cut(s) 147
Sse9I AATT 1 cut(s) 160
TaaI ACNGT 2 cut(s) 196, 245
TaqI TCGA 3 cut(s) 171, 223, 240
TasI AATT 1 cut(s) 160
TfiI GAWTC 1 cut(s) 225
Tru1I TTAA 2 cut(s) 164, 292
Tru9I TTAA 2 cut(s) 164, 292
TseFI GTSAC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 245
TspDTI ATGAA 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 132
VpaK11BI GGWCC 1 cut(s) 147
XmiI GTMKAC 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.